Feeds:
Posts
Comments

Archive for the ‘Amygdala’ Category

6377650365_0a712cf431_z

Genes that confer risk for illness are ideal targets for prevention and treatment.  So, also, are genes associated with natural or treatment-based RECOVERY from illness.  In a search for “recovery genes”, association studies in women who have recovered from eating disorders (ED) vs. those who are still struggling to recover reveals that the C-allele of rs17536211 is associated with recovery.

From Bloss et al.:  ”Given the substantial genetic component in the etiology of EDs in general, it follows that there may be genetic variants that contribute to the likelihood of recovery.”

“These were women who were over age 25 years, carried a lifetime diagnosis of either AN, BN, or ED-NOS (ie, subthreshold AN or BN), and for whom data were available regarding the presence (n=361 endorsed ongoing ED symptoms in the past year and considered ‘ill’) or absence (n=115 no ED symptoms in the past year and considered ‘recovered’) of ED symptoms.”

“rs17536211, an intronic SNP in GABRG1 on chromosome 4, showed the strongest statistical evidence of association with a GC-corrected p-value of 4.63 × 10−6, which corresponds to an FDR of 0.021 (Figure 1). The odds ratio (OR) observed for this SNP is 0.46, suggesting that possession of copies of the minor allele [C] is protective from long-term chronic illness (ie, it is associated with recovery).”

How might this SNP confer a protective effect?  The authors review data on the role of GABRG1 subunits in the un-learning of conditioned fear responses ["GABRG1 subunits are found in the lateral inputs, a region that arises from the intercalated cells masses, and is thought to be responsible for mediating inhibition of amygdala output during extinction of conditioned fear (Likhtik et al, 2008)"] and suggest that individuals with the protective C-alleles may be slightly more able to uncouple eating from a very real and debilitating fear response.

*photo credit

Read Full Post »

Hey genome, why U make me stink at networking?

If only there was an allele that LESSENED the apprehensive and uncomfortable feelings I get when meeting new people.

As such negative feelings are the work of my amygdala, I’m wishing for some sort of LOSS-OF-FUNCTION allele that REDUCES the activity of neural circuits involved in the emotional processing of fear … but leaves other neural circuits untouched.

I just want something that takes the edge off new social experiences … yunno?

How about rs33977775 ? It contains a derived (as opposed to ancestral) T-allele that causes a Y135F change that disrupts the binding sites of the NPBWR1 receptor to its neuropeptide ligands (ie. LOSS-OF-FUNCTION).  Amazingly, this receptor has a restricted pattern of gene expression only among limbic circuits involved in emotion and reward processing (ie. EXPRESSED IN EMOTION PROCESSING CIRCUITS ONLY).

In their report, a team of authors measured the reactions of 126 university students to various social stimuli and report that individuals who carry one of these loss-of-function T-alleles (about 30% of the population) show a more positive response to social interactions.

“… the AT group perceived facial expressions more pleasantly than did the AA group, regardless of the category of facial expression. Statistical analysis … also showed that the AT group tended to feel less submissive to an angry face than did the AA group.”

So it seems that rs33977775 may dial down the amygdala response to social stimuli … just enough to ace the job interview, but not so much that you inappropriately hug your new boss. Nice!

Unfortunately, this SNP is not covered by 23andMe v3 and there is no report yet on linkage disequilibrium via 1000 genomes.  Since the frequency of the T-allele is low in African populations (1%) and about 10%-ish in other non-African populations, I guess the odds are that I’m an AA or AT.

Read Full Post »

Dear Mrs. Jones,

The genetic profiling results show that your son carries 2 copies of the so-called “short” allele at the serotonin transporter linked polymorphic region (5-HTTLPR) and also 2 copies of the T allele of the G-703T polymorphism (rs4570625) in the tryptophan hydroxylase-2 (TPH2) gene.

Some studies find correlations between this genotype and higher amygdala activity – which, in turn – has been correlated with a number of anxiety-related traits and disorders.

In short, you may wish to expect that your son may grow up to be slightly more shy, bashful, diffident, inhibited, reticent, shrinking, hesitant, timid, apprehensive, nervous, wary, demure, coy, blushing, self-effacing, apprehensive, fearful, faint-hearted, wimpish, mousy, lily-livered, weak-kneed, unsure & doubtful.

Congratulations!  He will be a handful to raise as a child but one day make a great scientist, and an even better science blogger.


* thanks fyns for the pic.

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Drowning
Image by Sbrimbillina via Flickr

Here’s a gene whose relationship to mental function is very straightforward.  If you hold your breath, your blood pH falls (more CO2 leads to more free H+ protons dissolved in your blood stream).  You also may become anxious, or worse if you are forced to hold your breath.  How does this process work?

Ziemann et al., in their new paper, “The Amygdala Is a Chemosensor that Detects Carbon Dioxide and Acidosis to Elicit Fear Behavior” [doi 10.1016/j.cell.2009.10.029] show that the acid sensing ion channel-1a (ASIC1a) gene is a proton-sensing Na+ and Ca++ channel – designed to activate dendritic spines when sensing H+ and drive neuronal activity.  Mice that lack this gene are not sensitive to higher CO2 levels, but when the protein is replaced in the amygdala, the mice show fearful behavior in response to higher CO2 levels.  Mother nature has provided a very straightforward way – ASIC1a activation of our fear center – of letting us know that no oxygen is a BAD thing!

Reblog this post [with Zemanta]

Read Full Post »

Where da rodents kick it
Image by Scrunchleface via Flickr

A recent GWAS study identified the 3′ region of the liver- (not brain) expressed PECR gene (rs7590720(G) and rs1344694(T)) on chromosome 2 as a risk factor for alcohol dependency.  These results, as reported by Treutlein et al., in “Genome-wide Association Study of Alcohol Dependence” were based on a population of 487 male inpatients and a follow-up re-test in a population of 1024 male inpatients and 996 control participants.

The authors also asked whether lab rats who – given the choice between water-based and ethanol-spiked beverages over the course of 1 year – showed differential gene expression in those rats that were alcohol preferrers vs. alcohol non-preferring rats.  Among a total of 542 genes that were found to be differentially expressed in the amygdala and caudate nucleus of alcohol vs. non-alcohol-preferring rat strains,  a mere 3 genes – that is the human orthologs of these 3 genes – did also show significant association with alcohol dependency in the human populations.  Here are the “rat genes” (ie. human homologs that show differential expression in rats and association with alcohol dependency in humans): rs1614972(C) in the alcohol dehydrogenase 1C (ADH1C) gene, rs13273672(C) in the GATA binding protein 4 (GATA4) gene, and rs11640875(A) in the cadherin 13 (CDH13) gene.

My 23andMe profile gives a mixed AG at rs7590720, and a mixed GT at rs1344694 while I show a mixed CT at rs1614972, CT at rs13273672 and AG at rs11640875.  Boooring! a middling heterozygote at all 5 alcohol prefer/dependency loci.   Were these the loci for chocolate prefer/dependency I would be a full risk-bearing homozygote.

 

Reblog this post [with Zemanta]

Read Full Post »

old class photo with grandpa, 1923
Image by freeparking via Flickr

Back in the day, when the fam would get together at my parents’ house, I would enjoy shuffling through their box of old photos.  Looking at childhood pictures of myself and relatives, it was natural to compare our adult selves to the old pictures and look for similarities – emotional expressions, gestures, etc. – that have carried on through the years and are (were) a part of who we are (became) today.  It’s always amazing what you think you can see, and if you’re like me, you may be somewhat amazed by how much of your adult self was already in full swing as a child.  The manner in which the developing brain confers such stability over time and over generations (now I see my own childhood traits in my son – yikes!) is of course a timeworn question among families and scientists alike.

That the genome would contribute to cross generational parent-child similarities in personality and temperament is fairly obvious, but not so apparent is how the genome interacts with the environment to exert an influence on psychological development.  Along this line of inquiry, a research article entitled, “Influence of RGS2 on anxiety-related temperament, personality, and brain function” by Smoller and colleagues [free access] provides an amazing perspective – from a single gene.  RGS2, eponymously named as a regulator of G-protein signaling, was first identified as a factor that regulates emotional behavior in mice [PMID] and subsequently as a risk factor for schizophrenia [PMID] as well as anxiety disorders in humans [PMID].  In the current study, the team examined the temperament of children (119 families), personality of adults (744 undergraduates) and brain activity in adults (55 participants) to ascertain whether the adult risk for anxiety conferred by RGS2 might be related to actions of the gene that occur much earlier in development – such as on the systems that regulate temperament in children.  Specifically, they focused on behavioral inhibition in children (shy, avoidant, restrained in novel situations) and introversion in adults – as these traits have been associated with increased risk for anxiety disorders.

What is so interesting to me is that RGS2 (particularly the G allele of the 3′UTR SNP rs4606) was found to be associated with both childhood temperament and adult personality.  Thus, an introverted adult who looks through an old photo album and sees themselves to have been a shy or inhibited child, may be experiencing – to a small degree – the effects of the RGS2 gene.  The team suggests, via additional brain imaging-genetic studies, that RGS2 is of particular relevance to activity in circuits containing the insular cortex and amygdala – when subjects perform an emotional face matching task.

My own 23andme record does not contain the rs4606 SNP but does contain the data for rs1819741 where a T allele was significantly associated with introversion.  Since I’m a C/T heterozygote, I guess I’ll have to look a bit harder at my old pictures to see signs of behavioral inhibition.

Reblog this post [with Zemanta]

Read Full Post »

mouthComparisons of “healthy” vs. “disordered” genomes in psychiatry have not yet revealed sequence differences that can reliably predict the onset of mental disability.  Rather, such disability seems to arise from as-yet-undetermined complex, probablistic interactions of genetic risk and environmental factors over the course of development.  With this as the case, the demarcations between “healthy” and “disordered” may not be distinct, but rather fuzzy and hence unworthy of labels that give a false impression of being discrete states.

One recent paper that speaks to this issue is by Meyer-Lindenberg et al., “Genetic variants in AVPR1A linked to autism predict amygdala activation and personality traits in healthy humans” [doi: 10.1038/mp.2008.54].  Here, they explore genetic variation in the AVPR1A gene – a receptor for the pro-social neuropeptide vasopressin – and how it can modulate the activity of the amygdala when subjects view human faces (vs. a geometric shapes control condition).  Since it is well known that the amygdala responds to a wide range of social and emotional stimuli and that activation of the amygdala can enhance or prevent the storage of such emotional or socially arousing events – and - that this process goes awry in autism and in subjects with amygdala damage (the picture above shows that patients with amygdala damage do not focus on the eyes of human faces) – the investigators have indeed focused-in on a key set of neural processes.  They find the variation in the RS1 and RS3 polymorhphic sites in AVPR1a do indeed correlate with amygdala activity in healthy controls who were carefully screened for no history of mental disability.  A great example of folks who carry the “healthy” label, but also the genetic risk and the neural correlates of autism.

Reblog this post [with Zemanta]

Read Full Post »

Cingulum (anatomy)
Image via Wikipedia

One of the most well-studied genetic polymorphisms in the behavioral- psychiatric- cognitive-genetics area is the 5HTT-LPR, a short repeating sequence that mediates the transcriptional efficiency of the serotonin transporter.  Given the wide-ranging effects of 5HTT on the developing and mature nervous system, it is perhaps not surprising that variation in 5HTT levels can have wide-ranging effects on brain structure, function and behavior (see here and here for 2 of my own posts on this).  One of the latest findings has to do with the issue of  “functional connectivity” or the degree to which 2 separate brain regions co-activate and interact with each other – this type of functional interaction and integration of brain systems being a good thing.

Earlier studies have shown that individuals who carry the “short” allele at the 5HTT-LPR show less coupling of their frontal cortex (perigenual anterior cingulate cortex) with their amygdala – which perhaps indicates that their frontal cortex has a harder time regulating the amygdala.  This may be a mechanistic explanation for why such people have been found to be more prone to anxiety.  A new study by Pachecco et al., seems to support this mechanistic account -  however, they confirm the coupling model using a different neuroimaging modality – which makes the paper especially interesting.  In their article, “Frontal-Limbic White Matter Pathway Associations with the Serotonin Transporter Gene Promoter Region (5-HTTLPR) Polymorphism” [doi: 10.1523/JNEUROSCI.0896-09.2009] use a method known as diffusion tensor imaging, a modality that is particularly sensitive to white matter tracts that are known to function as high-speed interlinks between disparate areas of the brain.  They find that a particular tract – the left frontal uncinate fasciculus - is differentially formed, and is less so, in carriers of the short allele.  The authors suggest that the association of the 5HTT-LPR with functional connectivity may be somewhat due to the white matter tracts that connect separate brain regions.  Interestingly, the finding was not seen in other white matter tracts (fasciculi) – which suggests that the genetic polymorphism is interacting with other – yet to be identified – factors (environment perhaps?) that lead to such a specific difference.

Reblog this post [with Zemanta]

Read Full Post »

facial expressions
Image by ibiscus27 via Flickr

One of the difficulties in understanding mental illness is that so many aspects of mental life can go awry – and its a challenge to understand what abnormalities are directly linked to causes and what abnormalities might be consequences or later ripples in a chain reaction of neural breakdown.  Ideally, one would prefer to treat the fundamental cause, rather than only offer palliative measures for symptoms that arise from tertiary neural inefficiencies. In their research article entitled, “Evidence That Altered Amygdala Activity in Schizophrenia Is Related to Clinical State and Not Genetic Risk“, [doi: 10.1176/appi.ajp.2008.08020261] (audio link) Rasetti and colleagues explore this issue.

Specifically, they focus on the function of the amygdala and its role in responding to, and processing, social and emotional information.  In schizophrenia, it has been found that this brain region can be somewhat unresponsive when viewing faces displaying fearful expressions – and so, the authors ask whether the response of the amygdala to fearful faces is, itself, an aspect of the disorder that can be linked to underlying genetic risk (a type of core, fundamental cause).

To do this, the research team assembled 3 groups of participants: 34 patients, 29 of their unaffected siblings and 20 demographically and ethnically matched control subjects.  The rationale was that if a trait – such as amygdala response – was similar for the patient/sibling comparison and dissimilar for the patient/control comparison, then one can conclude that the similarity is underlain by the similarity or shared genetic background of the patients and their siblings.  When the research team colected brain activity data in response to a facial expression matching task performed in an MRI scanner, they found that the patient/sibling comparison was not-similar, but rather the siblings were more similar to healthy controls instead of their siblings.  This suggests that the trait (amygdala response) is not likely to be directly related to core genetic risk factor(s) of schizophrenia, but rather related to apsects of the disorder that are consequences, or the state, of having the disorder.

A follow-up study using a different trait (prefrontal cortex activity during a working memory task) showed that this trait was similar for the patient/sibling contrast, but dissimilar for the patient/control contrast – suggesting that prefrontal cortex function IS somewhat linked to core genetic risk.  Congratulations to the authors on this very informative study!

Reblog this post [with Zemanta]

Read Full Post »

Flash circuit

Image by cibomahto via Flickr

A recent paper from Andreas Heinz and colleagues (doi: 10.1038/nn2222) provides more neuroimaging evidence in humans for a a circuit that regulates our responsivity to stimuli that evoke emotional responses.  The basic circuitry involves the amygdala (a place in the brain where emotional memories are registered), the prefrontal cortex (a part of the brain that is involved in making decisions and assessing threats) and the cingulate cortex (a place in the brain where expectations are compared to sensory inputs & outgoing responses).  These 3 brain regions are interconnected in a loop through various synaptic contacts and the responsivity of these synapses can be modulated by neuomodulators such as dopamine, serotonin and noradrenaline.  It turns out, that several neuroimaging studies have begun to demonstrate that this (relatively) simple circuitry underlies human personality and temperament. In the Heinz study, the level of dopamine that was released into the amygdala was correlated with levels of functional activation to emotional stimuli as well as a dimension of temperament known as negative affect.

I recall once having taken the Meyers-Briggs assessment in graduate school and had a blast comparing my results with my wife – who was almost my polar opposite. Now, the latest neuroimaging and imaging-genetic research has begun to explain the complexities of human personality in basic neural circuitry where genes such as 5HTT and MAOA ‘turn up’ or turn down’ the gain on various synaptic contacts in this circuit – leading to the immense, yet systematic variation in personality and temperament that makes our social lives so interesting.  As I navigate my way through marriage and parenthood, I’m often glad I took the personality test with my wife many years ago.  It always helps to see things from the other person’s perspective.  Now, as she obtains her 23andMe profile, perhaps we will begin to compare our genomes together – the ultimate form of marriage counseling !!  Click here for more personality tests.

Reblog this post [with Zemanta]

Read Full Post »

One of several versions of the painting Image via Wikipedia Many of the unpleasant feelings and physiological changes associated with fear and anxiety can be traced back to a tiny brain region known as the amygdala. Neuroimaging studies often find this region abnormally active in people having difficulty down-regulating negative emotions. It is no surprise then, that when genes that regulate innate fear and the reactivity of this brain region are identified there is much hope for future medications that might target these biochemical pathways and relieve emotional suffering. So it is that Coryell and colleagues identify such a gene, ASIC1a, the acid sensing ion channel 1a, and report in their paper, “Targeting ASIC1a Reduces Innate Fear and Alters Neuronal Activity in the Fear Circuit(DOI) and report that more expression of this gene results in mice with more innate fear and, that less expression or blockade of this gene results in less innate fear. The gene appears expressed in a well-studied fear circuit including the cingulate cortex, the amygdala and the bed nucleus of the stria terminalis, so any type of pharmacologic manipulation would be predicted to affect the entire fear circuit. The normal function of ASIC1a – a proton sensor – is presumably to regulate pH within and/or across cell membranes. Such changes in pH are known to affect synaptic transmission in a manner such that lower pH inhibits NMDA channels and higher pH activates NMDA channels, so it is possible that the effects of ASIC1a on fear may be ultimately due to effects on synaptic plasticity. An exciting candidate not to be feared.

Related articles by Zemanta

Reblog this post [with Zemanta]

Read Full Post »

Follow

Get every new post delivered to your Inbox.

Join 30 other followers