I’m so lonely sometimes, but I never want to go out. I have 2 “A” alleles at rs53576 (link to science).
Archive for the ‘OXTR’ Category
rs53576 AA (not GG)
Posted in OXTR, tagged Empathy, loneliness, social on November 12, 2012 | Leave a Comment »
Look deeply into my eyes and let me see your genes
Posted in OTR, OXTR, tagged altruism, autism, Emotion, Empathy, evolution, Functional magnetic resonance imaging, Gene expression, Genetics, genome sharing, group selection, Human genome, loneliness, Natural selection, oxytocin, Psychology, social psychology, Social Sciences on November 24, 2009 | 1 Comment »
*** PODCAST accompanies this post ***
Nowadays, it seems that genomics is spreading beyond the rarefied realm of science and academia into the general, consumer-based popular culture. Quelle surprise!? Yes, the era of the personal genome is close at hand, even as present technology provides – directly to the general consumer public – a genome-wide sampling of many hundreds of thousands of single nucleotide variants. As curious early adopters begin to surf their personal genomic information, one might wonder how they, and homo sapiens in general, will ultimately utilize their genome information. Interestingly, some have already adapted the personal genome to facilitate what homo sapiens loves to do most – that is, to interact with one another. They are at the vanguard of a new and hip form of social interaction known as “personal genome sharing”. People connecting in cyberspace – via haplotype or sequence alignment – initiating new social contacts with distant cousins (of which there may be many tens of thousands at 5th cousins and beyond). Sharing genes that regulate the social interaction of sharing genes, as it were.
A broader view of social genes, within the context of our neo-Darwinian synthesis, however, shows that the relationship between the genome and social behavior can be rather complex. When genes contribute directly to the fitness of an organism (eg. sharper tooth and claw), it is relatively straightforward to explain how novel fitness-conferring genetic variants increase in frequency from generation to generation. Even when genetic variants are selfish, that is, when they subvert the recombination or gamete production machinery, in some cases to the detriment of their individual host, they can still readily spread through populations. However, when a new genetic variant confers a fitness benefit to unrelated individuals by enhancing a cooperative or reciprocally-altruistic form of social interaction, it becomes more difficult to explain how such a novel genetic variant can take hold and spread in a large, randomly mating population. Debates on the feasibility natural selection acting “above the level of the individual” seem settled against this proposition. However, even in the face of such difficult population genetic conundrums, research on the psychology, biology and evolutionary genetics of social interactions continues unabated. Like our primate and other mammalian cousins, with whom homo sapiens shares some 90-99% genetic identity, we are an intensely social species as our literature, poetry, music, cinema, not to mention the more recent twittering, myspacing, facebooking and genome-sharing demonstrate.
Indeed, many of the most compelling examples of genetic research on social interactions are those that reveal the devastating impacts on psychological development and function when social interaction is restricted. In cases of maternal and/or peer-group social separation stress, the effects on gene expression in the brain are dramatic and lead to long-lasting consequences on human emotional function. Studies on loneliness by John Cacioppo and colleagues reveal that even the perception of loneliness is aversive enough to raise arousal levels which, may, have adaptive value. A number of specific genes have been shown to interact with a history of neglect or maltreatment in childhood and, subsequently, increase the risk of depression or emotional lability in adulthood. Clearly then, despite the difficulties in explaining how new “social genes” arise and take hold in populations, the human genome been shaped over evolutionary time to function optimally within the context of a social group.
From this perspective, a new paper, “Oxytocin receptor genetic variation relates to empathy and stress reactivity in humans” by Sarina Rodrigues and colleagues [doi.org/10.1073/pnas.0909579106] may be of broad interest as a recent addition to a long-standing, but now very rapidly growing, flow of genetic research on genes and social interactions. The research team explored just a single genetic variant in the gene encoding the receptor for a small neuropeptide known as oxytocin, a protein with well-studied effects on human social interactions. Intra-nasal administration of oxytocin, for example, has been reported to enhance eye-gaze, trust, generosity and the ability to infer the emotional state of others. In the Rodrigues et al., study, a silent G to A change (rs53576) within exon 3 of the oxytocin receptor (OXTR) gene is used to subgroup an ethnically diverse population of 192 healthy college students who participated in assessments for pro-social traits such as the “Reading the Mind in the Eyes” (RMET) test of empathetic accuracy as well as measures of dispositional empathy. Although an appraisal of emotionality in others is not a cooperative behavior per se, it has been demonstrated to be essential for healthy social function. The Rodrigues et al., team find that the subgroup of students who carried the GG genotype were more accurate and able to discern the emotional state of others than students who carried the A-allele. Such molecular genetic results are an important branching point to further examine neural and cognitive mechanisms of empathy as well as long-standing population genetic concerns of how new genetic variants like the A-allele of rs53576 arose and managed to take-hold in human populations.
Regarding the latter, there are many avenues for inquiry, but oxytocin’s role in the regulation of the reproductive cycle and social behavior stands out as an ideal target for natural selection. Reproductive and behavioral-genetic factors that influence the ritualized interactions between males and females have been demonstrated to be targets of natural selection during the process of speciation. New variants can reduce the cross-mating of closely related species who might otherwise mate and produce sterile or inviable hybrid offspring. So-called pre-mating speciation mechanisms are an efficient means, therefore, to ensure that reproduction leads to fit and fertile offspring. In connection with this idea, reports of an eye-gaze assessment similar to the RMET test used by Rodrigues et al., revealed that women’s pupils dilate more widely to photos of men they were sexually attracted to during their period of the menstrual cycle of greatest fertility, thus demonstrating a viable link between social preference and reproductive biology. However, in the Rodrigues et al., study, it was the G-allele that was associated with superior social appraisal and this allele is not the novel allele, but rather the ancestral allele that is carried by chimpanzees, macaques and orangutans. Therefore, it does not seem that the novel A-allele would have been targeted by natural selection in this type of pre-mating social-interaction scenrio. Might other aspects of OXTR function provide more insight then? Rodrigues et al., explore the role of the gene beyond the social interaction dimension and note that OXTR is widely expressed in limbic circuitry and also plays a broader modulatory role in many emotional reactivity. For this reason, they sought to assess the stress responsivity of the participants via changes in heart-rate that are elicited by the unpredictable onset of an acoustic startle. The results show that the A-allele carriers showed greater stress reactivity and also greater scores on a 12-point scale of affective reactivity. Might greater emotional vigilance in the face of adversity confer a fitness advantage for A-allele carriers? Perhaps this could be further explored.
Regarding the neural and cognitive mechanisms of empathy and other pro-social traits, the Rodrigues et al., strategy demonstrates that when human psychological research includes genetic information it can more readily be informed by a wealth of non-human animal models. Comparisons of genotype-phenotype correlations at the behavioral, physiological, anatomical and cellular levels across different model systems is one general strategy for generating hypotheses about how a gene like OXTR mediates and moderates cognitive function and also why it (and human behavior) evolved. For example, mice that lack the OXTR gene show higher levels of aggression and deficits in social recognition memory. In humans, genetic associations of the A-allele with autism, and social loneliness form possible translational bridges. In other areas of human psychology such as in the areas of attention and inhibition, several genetic variants correlate with specific mental operations and areas of brain activation. The psychological construct of inhibition, once debated purely from a behavioral psychological perspective, is now better understood to be carried out by a collection of neural networks that function in the lateral frontal cortex as well as basal ganglia and frontal midline. Individual differences in the activation of these brain regions have been shown to relate to genetic differences in a number of dopaminergic genes, whose function in animal models is readily linked to the physiologic function of specific neural circuits and types of synapses. In the area of social psychology, where such types of neuroimaging-genetic studies are just getting underway, the use of “hyper-scanning”, a method that involves the simultaneous neuroimaging of two or more individuals playing a social game (prisoners dilemma) reveals a co-activation of dopamine-rich brain areas when players are able to make sound predictions of other participant’s choices. These types of social games can model specific aspects of reciprocal social interactions such as trust, punishment, policing, sanctions etc. that have been postulated to support the evolution of social behavior via reciprocal altruism. Similar imaging work showed that intra-nasal administration of oxytocin potently reduced amygdala activation and decreased amygdala coupling to brainstem regions implicated in autonomic and behavioural manifestations of fear. Such recent examples affirm the presence of a core neural circuitry involved in social interaction whose anatomical and physiological properties can be probed using genetic methods in human and non-human populations.
Although there will remain complexities in explaining how new “social genes” can arise and move through evolutionary space and time (let alone cyberspace!) the inter-flows of genetic data and social psychological function in homo sapiens will likely increase. The rising tide should inevitably force both psychologists and evolutionary biologists to break out of long-standing academic silos and work together to construct coherent models that are consistent with cognitive-genetic findings as well as population- genetic and phylogenetic data. Such efforts will heavily depend on a foundation of psychological research into “social genes” in a manner illustrated by Rodrigues et al.
*** PODCAST accompanies this post *** Thanks agian Dr. Rodrigues!!!
Remarks
gpcox on It’s my gene pool and I… synapticcohesion on Mother Nature has been writing… Tam on Astrocytes hold dendrites in a… James Rayment on The vagus nerve as a living Ku… thesingernurse on DRD4 and gene-twitter interact… Dr Robert Peers on Are individual differences in… dendrite on Genomic solutions for really b… Neural Outlet.. on Genomic solutions for really b… cariaso on Are there genes for my favorit… dreambot on The vagus nerve as a living Ku… Aubrey de Grey Gets… on Movie star SIRT1 makes for a g… Kala Pierson on What is the sound of Aum? Jeremy Peirce on What is the sound of Aum? Alexei Morozov on red purple blue dendrite on Genetic testing across the US… Re-Tweetin’
- RT @decodingannie: "There are so many ways to do a film about cancer wrong. Thankfully, “Decoding Annie Parker” manages to find a... http:/… 2 weeks ago
- RT @mindhacksblog: National Institute of Mental Health abandoning the DSM: In a potentially seismic move, the National Institute ... http:/… 2 weeks ago
- RT @genomesunzipped: Learning more from your 23andMe results with imputation genomesunzipped.org/2013/03/learni… 3 weeks ago
- RT @JoshYTsui: The internet is done! Cat dressed as shark riding a roomba chasing a baby duck. That's it, ship it. 24.media.tumblr.com/69861666232198… 1 month ago
- RT @sarcastic_f: I sure feel sorry for people who had to present posters during talks by ledoux and posner. #cns2013 1 month ago
- When genes don't matter, except when they do ... a lot wp.me/pqWMQ-150 1 month ago
- RT @vsbuffalo: Some first results from my new DNA dice: ATTCAGCTTTCCCGCAACATGGGCGCACCC ericharshbarger.org/dice/ 2 months ago
- RT @nygenome: How a Whitehead Institute Scientist Was Able to Identify Anonymous DNA Donors #PMWCintl bit.ly/WxKdqA 3 months ago
Blog Stats
- 95,989 clickitas
Posting since April 2007
Blogroll
General topics
23andMe Add new tag aging Art Arts autism Biology Brain Central nervous system Cognition comics Consciousness Depression Development DNA Dopamine economics Emotion Epigenetics evolution Frontal lobe Functional magnetic resonance imaging Gene Gene expression Genetics Genetic testing Health Health insurance Meditation meme-art Memory Mental disorder Mental health Mind Neuron Personalized medicine Psychology Religion and Spirituality schizophrenia Social Sciences spirituality Teachers and Centers Twin Yoga Yoga Sutras of PatanjaliSpecific Items
- 5HTT
- ABCB1
- acetylcholine
- Actin
- ACTN3
- ADH1C
- ADORA2A
- ADRA2A
- AKT
- AMPA receptor
- Amygdala
- Angular gyrus
- ANK3
- APOE
- ARHGAP18
- ASIC1a
- ASPM
- ATXN1
- AVPR1a
- BAF53b
- Basal Ganglia
- BDNF
- CABYR
- CACNA1C
- CACNA2D1
- Caudate nucleus
- CB1 receptor
- CDC34
- CDH13
- Cell adhesion molecules
- Cerebellum
- CHAT
- CHRM3
- CHRNA4
- CHRNA7
- Chromosome structural variants
- Cingulate cortex
- Circadian
- clinical trial
- CNR1
- CNTNAP2
- Collateral sulcus
- COMT
- Corpus callosum
- COX1
- CREB
- CRHR1
- DARPP32
- DAT
- default network
- DISC1
- DLPFC
- DNMT
- Dopamine
- DPP4
- DRD2
- DRD4
- DTNBP1
- DYRK1A
- EDA2R
- EGR1
- Estrogen
- evolution
- FGF20
- FMR1
- FNBP1L
- FOXA2
- FOXP2
- Frontal cortex
- Frontal pole
- Fusiform gyrus
- G-protein
- GAB2
- GABA
- GABRA2
- GABRG1
- GATA4
- Glucocorticoid receptor
- Glutamate
- GPR6
- GRIA3
- GRIK2
- GTPase
- HDACs
- Hippocampus
- HOXB8
- HRK
- HTR2A
- Hypothalamus
- IL3
- immunity
- Inferior frontal gyrus
- Insula
- Intronic or repetitive sequences
- Kalirin
- KCNA2
- KCNH2
- KCNIP3
- KCNJ6
- Kinesin
- Lateral septum
- Lateral ventricle
- LDB1
- Leptin
- LIMK1
- Locus coeruleus
- MAOA
- MAPK
- MCPH1
- MCR1-4
- MDGA2
- MECP2
- meditation
- MET
- metabolism
- MHC loci
- microRNA
- Middle frontal gyrus
- middle occipital gyrus
- Middle temporal gyrus
- Mindfulness
- Mitochondria
- MKP-1
- Motor cortex
- Myelin
- Neural crest
- NEUROG1
- NLGN3/4
- Noradrenaline
- NPBWR1
- NPSR1
- NRG1
- NRXB1
- NTRK2
- Nucleus accumbens
- NURR1
- Olfactory bulb
- OPRM1
- Orbitofrontal cortex
- OTR
- OXTR
- Parahippocampal gyrus
- Parasympathetic NS
- Parietal cortex
- PARP-1
- PAX6
- PCLO
- PER1
- PINK1
- PLCB1
- Posterior parietal cortex
- PSD95
- Putamen
- quantum physics
- RARB
- RGS2
- RGS4
- Rho GTPase
- RLN
- ROR1
- RORB
- Rostral fronto-occipital fasciculus
- RSRC1
- SAPAP3
- self-awareness
- SEMA(1-7)
- SETDB1
- SEZ6
- SIRT1
- SLC1A1
- SLITRK1
- SNAP25
- SNORD115
- SNRPN
- SOD2
- Somatosensory cortex
- SRPX2
- Stria terminalis
- Striatum
- Substantia nigra
- Subthalamic nucleus
- Superior temporal cortex
- Suprachiasmatic nucleus
- Supramarginal gyrus
- SWI/SNF
- Sylvian fissure
- Telomere
- Temporal lobe
- TGF-alpha
- TH
- Thalamus
- Thap1
- THBS1
- THBS2
- TNF-alpha
- Torsin A
- TPH2
- UBE3A
- UGT2B17
- Uncategorized
- Vagus
- VEGF
- Ventral tegmental area
- VGF
- Visual cortex
- White matter
- Yoga and Meditation
- ZNF804A

![Reblog this post [with Zemanta]](http://img.zemanta.com/reblog_e.png?x-id=76e4cf1a-8df0-4bdf-a5f6-f6c49f055704)