Feeds:
Posts
Comments

Posts Tagged ‘Cognition’

Telomere
Image via Wikipedia

This is a cross post from my other “science & self-exploration” blog about mindfulness and the mind-body connection (yoga).

In 2009, Elizabeth Blackburn received the Nobel Prize in Physiology or Medicine for her work on the biology of so-called telomeres – the DNA sequences found at the end of our chromosomes (actually just a repeating sequence of TTAGGG). The very cool thing about telomeres is that the overall length of these sequences (number of repeating units of TTAGGG) correlates with life-span. This is because as cells in your body are born, they go through a number of cell divisions (each time the cell divides, the telomeres shorten) until they go kaput (replicative senescence). Amazingly, regular cells like these (that normally die after several cell divisions) can be induced to live far longer by simply – lengthening their telomeres (increasing the amount of a telomere lengthening enzyme known as telomerase) – which is why some think of telomeres as the key to cellular immortality.

Imagine your own longevity if all your cells lived twice as long.

With this in mind, it was awesome to read a paper by Dr. Blackburn and colleagues entitled, “Can Meditation Slow Rate of Cellular Aging? Cognitive Stress, Mindfulness, and Telomeres” [doi: 10.1111/j.1749-6632.2009.04414.x]. The authors carefully ponder – but do not definitively assert – a connection between meditative practices and telomere length (and therefore, lifespan). The main thrust of the article is that there are causal links between cellular stress and telomere length AND causal links between physiological stress and meditative practices. Might there, then, be a connection between meditative practices and telomere length?

Above we have reviewed data linking stress arousal and oxidative stress to telomere shortness. Meditative practices appear to improve the endocrine balance toward positive arousal (high DHEA, lower cortisol) and decrease oxidative stress. Thus, meditation practices may promote mitotic cell longevity both through decreasing stress hormones and oxidative stress and increasing hormones that may protect the telomere.

Given that eastern meditative practices are thousands of years old, its strange to say, but these are early days in beginning to understand HOW – in terms of molecular processes – these practices might influence health.

Still, I think I’ll send some thoughts to my telomeres next meditation session!

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Yogi Holy Man, India, c. 1900
Image by whatsthatpicture via Flickr

This post is part of an ongoing exploration of  “mindfulness” biology and the neurobiology of reflecting inwardly on one’s mental life.  I hope it helps support the self-discovery aim of the blog.

In some ways, the 8 limbs of yoga described in the yoga sutras, seem a bit like a ladder, rather than a concentric set of outreached arms or spokes on a wheel.  As I practice this form of postures and mindfulness, it seems like I’m working toward something.  But what?  I certainly feel healthier, and also enjoy the satisfaction of getting slightly more able (ever so slightly) to shift into new postures – so am quite motivated to continue the pursuit.  Perhaps this is how yoga got started eons ago?   Just a pursuit that – by trial and error – left its practitioners feeling more healthy, relaxed and more in touch with their outer and inner worlds?  But where does this path lead, if anywhere?

I was intrigued by a report published in 1973 by an 8-day study carried out on the grounds of the Ravindra Nath Tagore Medical College and Hospital, Udaipur, India and subsequent letter, “The Yogic claim of voluntary control over the heart beat: an unusual demonstration” published in the American Heart Journal, Volume 86 Number 2.  Apparently, a local yogi named Yogi Satyamurti:

Yogi Satyamurti, a sparsely built man of about 60 years of age, remained confined in a small underground pit for 8 days in what according to him was a state of “Samadhi,” or deep meditation, with all bodily activity cut down to the barest minimum.

The medical researchers had the yogi’s heart and other physiological functions under constant watch via electrical recording leads, and watched as the yogi’s heart slowed down (their equipment registered a flatline) a remained so for several days.  Upon opening up the pit, the researchers found:

The Yogi was found sitting in the same posture. One of us immediately went in to examine him. He was in a stuporous condition and was very cold (oral temperature was 34.8O C) [the same temperature as the earth around him].

After a few hours, the yogi had recovered from the experience and displayed normal physiological and behavioral function – despite 8 days underground (air supposedly seeped in from the sides of the pit) with no food or human contact!

An amazing feat indeed – one that has some scientists wondering about the psychology and physiology that occurs when advanced meditators sink into (very deep) states.  John Ding-E Young and Eugene Taylor explored this in an article entitled, “Meditation as a Voluntary Hypometabolic State of Biological Estivation” published in News Physiol. Sci., Volume 13, June 1998.   They  suggest that humans have a kind of latent capacity to enter a kind of dormant or  hibernation-like state that is similar to other mammals and even certain primates.

Meditation, a wakeful hypometabolic state of parasympathetic dominance, is compared with other hypometabolic conditions, such as sleep, hypnosis, and the torpor of hibernation. We conclude that there are many analogies between the physiology of long-term meditators and hibernators across the phylogenetic scale. These analogies further reinforce the idea that plasticity of consciousness remains a key factor in successful biological adaptation.

Practice, practice, practice – towards an ability to engage a latent evolutionary adaptation? Such an adaptation – in humans – sounds hokey, but certainly an interesting idea worth exploring more in the future.

Enhanced by Zemanta

Read Full Post »

03.23.09 [#082] Yogurt Reach
Image by Jeezny via Flickr

Pity the poor brain.  What a job it has!  Did you know that just to reach into a refrigerator and grab a glass of milk, involves at least 50 or so key muscles in the hand, arm and shoulder which can, in principle, lead to over 1,000,000,000,000,000 possible combinations of muscle contractions?  Just so you know, this is 1,000 times MORE contraction possibilities than there are neurons in the brain (only a mere 1,000,000,000,000 neurons).  I’m sorry brain, I’ll keep my hands out of the fridge, I promise!

To accomplish this computational feat, Rodolfo R. Llinas and Sisir Roy in their paper entitled, “The ‘prediction imperative’ as the basis for self-awareness” [doi:10.1098/rstb.2008.0309] suggest that brain has evolved a number of strategies.

For starters, the authors point out that the brain can lower the computational workload of controlling motor output by sending motor control signals in a non-continuous and pulsatile fashion.

“We see that the underlying nature of movement is not smooth and continuous as our voluntary movements overtly appear; rather, the execution of movement is a discontinuous series of muscle twitches, the periodicity of which is highly regular.”

This computational strategy has the added benefit of making it easier to bind and synchronize motor-movement signals with a constant flow of sensory input:

“a periodic control system may allow for input and output to be bound in time; in other words, this type of control system might enhance the ability of sensory inputs and descending motor command/controls to be integrated within the functioning motor apparatus as a whole.“

Another strategy is the use of memory for the purposes of prediction (actually, their paper is part of a special theme issue from the Philosophical Transactions of the Royal Society B entitled, Predictions in the brain: using our past to prepare for the future).  The authors describe the way in which neural circuits in the body and brain are inherently good at learning and storing information which makes them very good at using that information for making predictions and pre-prepared plans for what to do with expected incoming sensory inputs.  These neural mechanisms may also help reduce computational loads associated with moving and coordinating the body.  Interestingly, the authors note,

“while prediction is localized in the CNS, it is a distributed function and does not have a single location within the brain. What is the repository of predictive function? The answer lies in what we call the self, i.e. the self is the centralization of the predictive imperative.  The self is not born out of the realm of consciousness—only the noticing of it is (i.e. self-awareness).”  Here’s a link to Llinas’ book on where the “self” resides.

Lastly, the authors suggest that the genome might encode certain structural and functional aspects of neural development that create a bias for certain types of computation and prime neural networks with a Bayesian type of prior knowledge.  Their idea is akin to an organism being “experience expectant” rather than a pure blank slate that has to learn every stimulus-response contingency by trial-and-error.  To support their notion of the role of the genome, the authors cite a 2003 study from the Yonas Lab on the development of depth perception.  Another related study is covered here.

Methinks that genetic variants might someday be understood in terms of how they bias computational processes.  Something to shoot for in the decades to come!

Enhanced by Zemanta

Read Full Post »

According to wikipedia, “Jean Philippe Arthur Dubuffet (July 31, 1901 – May 12, 1985) was one of the most famous French painters and sculptors of the second half of the 20th century.”  “He coined the term Art Brut (meaning “raw art,” often times referred to as ‘outsider art’) for art produced by non-professionals working outside aesthetic norms, such as art by psychiatric patients, prisoners, and children.”  From this interest, he amassed the Collection de l’Art Brut, a sizable collection of artwork, of which more than half, was painted by artists with schizophrenia.  One such painting that typifies this style is shown here, entitled, General view of the island Neveranger (1911) by Adolf Wolfe, a psychiatric patient.

Obviously, Wolfe was a gifted artist, despite whatever psychiatric diagnosis was suggested at the time.  Nevertheless, clinical psychiatrists might be quick to point out that such work reflects the presence of an underlying thought disorder (loss of abstraction ability, tangentiality, loose associations, derailment, thought blocking, overinclusive thinking, etc., etc.) – despite the undeniable aesthetic beauty in the work.  As an ardent fan of such art,  it made me wonder just how “well ordered” my own thoughts might be.  Given to being rather forgetful and distractable, I suspect my thinking process is just sufficiently well ordered to perform the routine tasks of day-to-day living, but perhaps not a whole lot more so.  Is this bad or good?  Who knows.

However, Krug et al., in their recent paper, “The effect of Neuregulin 1 on neural correlates of episodic memory encoding and retrieval” [doi:10.1016/j.neuroimage.2009.12.062] do note that the brains of unaffected relatives of persons with mental illness show subtle differences in various patterns of activation.  It seems that when individuals are using their brains to encode information for memory storage, unaffected relatives show greater activation in areas of the frontal cortex compared to unrelated subjects.  This so-called encoding process during episodic memory is very important for a healthy memory system and its dysfunction is correlated with thought disorders and other aspects of cognitive dysfunction.  Krug et al., proceed to explore this encoding process further and ask if a well-known schizophrenia risk variant (rs35753505 C vs. T) in the neuregulin-1 gene might underlie this phenomenon.  To do this, they asked 34 TT, 32 TC and 28 CC individuals to perform a memory (of faces) game whilst laying in an MRI scanner.

The team reports that there were indeed differences in brain activity during both the encoding (storage) and retrieval (recall) portions of the task – that were both correlated with genotype – and also in which the CC risk genotype was correlated with more (hyper-) activation.  Some of the brain areas that were hyperactivated during encoding and associated with CC genotype were the left middle frontal gyrus (BA 9), the bilateral fusiform gyrus and the left middle occipital gyrus (BA 19).  The left middle occipital gyrus showed gene associated-hyperactivation during recall.  So it seems, that healthy individuals can carry risk for mental illness and that their brains may actually function slightly differently.

As an ardent fan of Art Brut, I confess I hoped I would carry the CC genotype, but alas, my 23andme profile shows a boring TT genotype.  No wonder my artwork sucks.  More on NRG1 here.

Reblog this post [with Zemanta]

Read Full Post »

wotd044
Image by theloushe via Flickr

** PODCAST accompanies this post**

I have a little boy who loves to run and jump and scream and shout – a lot.  And by this, I mean running – at full speed and smashing his head into my gut,  jumping – off the couch onto my head,  screaming – spontaneous curses and R-rated body parts and bodily functions.  I hope you get the idea.  Is this normal? or (as I oft imagine) will I soon be sitting across the desk from a school psychologist pitching me the merits of an ADHD diagnosis and medication?

Of course, when it comes to behavior, there is not a distinct line one can cross from normal to abnormal.  Human behavior is complex, multi-dimensional and greatly interpreted through the lens of culture.  Our present culture is highly saturated by mass-marketing, making it easy to distort a person’s sense of “what’s normal” and create demand for consumer products that folks don’t really need (eg. psychiatric diagnoses? medications?).   Anyhow, its tough to know what’s normal.  This is an important issue to consider for those (mass-marketing hucksters?) who might be inclined to promote genetic data as “hard evidence” for illness, disorder or abnormality of some sort.

With this in mind, I really enjoyed a recent paper by Stollstorff et al., “Neural response to working memory load varies by dopamine transporter genotype in children” [doi:10.1016/j.neuroimage.2009.12.104] who asked how the brains of healthy children functioned, even though they carry a genotype that has been widely associated with the risk of ADHD.  Healthy children who carry genetic risk for ADHD. Hmm, might this be my boy?

The researchers looked at a 9- vs. 10-repeat VNTR polymorphism in the 3′-UTR of the dopamine transporter gene (DAT1).  This gene – which encodes the very protein that is targeted by so many ADHD medications – influences the re-uptake of dopamine from the synaptic cleft.  In the case of 10/10 genotypes, it seems that DAT1 is more highly expressed, thus leading to more re-uptake and hence less dopamine in the synaptic cleft.  Generally, dopamine is needed to enhance the signal/noise of neurotransmission, so – at the end of the day – the 10/10 genotype is considered less optimal than the 9/9-repeat genotype.  As noted by the researchers, the ADHD literature shows that the 10-repeat allele, not the 9-repeat, is most often associated with ADHD.

The research team asked these healthy children (typically developing children between 7 and 12 years of age) to perform a so-called N-back task which requires that children remember words that are presented to them one-at-a-time.  Each time a new word is presented, the children had to decide whether that word was the same as the previous word (1-back) or the previous, previous word (2-back).  Its a maddening task and places an extreme demand on neural circuits involved in active maintenance of information (frontal cortex) as well as inhibition of irrelevant information that occurs during updating (basal ganglia circuits).

As the DAT1 protein is widely expressed in the basal ganglia, the research team asked where in the brain was variation in the DAT1 (9- vs. 10-repeat) associated with neural activity?  and where was there a further difference between 1-back and 2-back?  Indeed, the team finds that brain activity in many regions of the basal ganglia (caudate, putamen, substantia nigra & subthalamic nucleus) were associated with genetic variation in DAT1.  Neat!  the gene may be exerting an influence on brain function (and behavior) in healthy children, even though they do not carry a diagnosis.  Certainly, genes are not destiny, even though they do influence brain and behavior.

What was cooler to me though, is the way the investigators examined the role of genetic variation in the 1-back (easy or low load condition) vs. 2-back (harder, high-load condition) tasks.  Their data shows that there was less of an effect of genotype on brain activation in the easy tasks.  Rather, only when the task was hard, did it become clear that the basal ganglia in the 10/10 carriers was lacking the necessary brain activation needed to perform the more difficult task.  Thus, the investigators reveal that the genetic risk may not be immediately apparent under conditions where heavy “loads” or demands are not placed on the brain.  Cognitive load matters when interpreting genetic data!

This result made me think that genes in the brain might be a lot like genes in muscles.  Individual differences in muscle strength are not associated with genotype when kids are lifting feathers.  Only when kids are actually training and using their muscles, might one start to see that some genetically advantaged kids have muscles that strengthen faster than others.  Does this mean there is a “weak muscle gene” – yes, perhaps.  But with the proper training regimen, children carrying such a “weak muscle gene” would be able to gain plenty of strength.

I guess its off to the mental and physical gyms for me and my son.

** PODCAST accompanies this post** also, here’s a link to the Vaidya lab!

Reblog this post [with Zemanta]

Read Full Post »

If you’re a coffee drinker, you may have noticed the new super-sized portions available at Starbucks.  On this note, it may be worth noting that caffeine is a potent psychoactive substance of which – too much – can turn your buzz into a full-blown panic disorder.  The Diagnostic and Statistical Manual for psychiatry outlines a number of caffeine-related conditions mostly involving anxieties that can arise when the natural alertness-promoting effects are pushed to extremes.  Some researchers have begun to explore the way the genome interacts with caffeine and it is likely that many genetic markers will surface to explain some of the individual differences in caffeine tolerance.

Here’s a great paper, “Association between ADORA2A and DRD2 Polymorphisms and Caffeine-Induced Anxiety” [doi: 10.1038/npp.2008.17] wherein polymorphisms in the adenosine A2A receptor (ADORA2A encodes the protein that caffeine binds to and antagonizes) – as well as the dopamine D2 receptor (DRD2 encodes a protein whose downstream signals are normally counteracted by A2A receptors) — show associations with anxiety after the consumption of 150mg of caffeine (about an average cup of coffee – much less than the super-size, super-rich cups that Starbucks sells).  The variants, rs5751876 (T-allele), rs2298383 (T-allele) and rs4822492 (G-allele) from the ADORA2A gene as well as rs1110976 (-/G genotype) from the DRD2 gene showed significant increases in anxiety in a test population of 102 otherwise-healthy light-moderate regular coffee drinkers.

My own 23andMe data only provides a drop of information suggesting I’m protected from the anxiety-promoting effects.  Nevertheless, I’ll avoid the super-sizes.
rs5751876 (T-allele)  C/C – less anxiety
rs2298383 (T-allele) – not covered
rs4822492 (G-allele) – not covered
rs1110976 (-/G genotype) – not covered

Reblog this post [with Zemanta]

Read Full Post »

Summer, Brody and Audric Hug
Image by cobalt123 via Flickr

If you have a minute, check out this “Autism Sensory Overload Simulation” video to get a feel for the perceptual difficulties experienced by people with autism spectrum disorders.  A recent article, “Critical Period Plasticity Is Disrupted in the Barrel Cortex of Fmr1 Knockout Mice” [doi: 10.1016/j.neuron.2010.01.024] provides some clues to the cellular mechanisms that are involved in this phenomenon.  The authors examined the developing somatosensory cortex in lab mice who carry a mutation in a gene called FMR1.  The normal function of this gene is to help synapses mature and optimize their strength through a process known as activity-dependent plasticity.  This a kind of “use-it-or-lose-it” neural activity that is important when you are practicing and practicing to learn something new – say, like riding a bike, or learning a new language.  Improvements in performance that come from “using” the circuits in the brain are correlated with optimized synaptic connections – via a complex set of biochemical reactions (eg. AMPA receptor trafficking).

When FMR1 is not functioning, neuronal connections (in this case, synapses that connect the thalamus to the somatosensory cortex) cannot mature and develop properly.  This wreaks havoc in the developing brain where maturation can occur in successive critical periods – where the maturation of one circuit is needed to ensure the subsequent development of another.  Hence, the authors suggest, the type of sensory overload reported in the autism spectrum disorders may be related to a similar type of developmental anomaly in the somatosensory cortex.

Reblog this post [with Zemanta]

Read Full Post »

Novelty candles may be used.
Image via Wikipedia

Everyone has a birthday right. Its the day you (your infant self) popped into the world and started breathing, right?  But what about the day “you” were born – that is – “you” in the more philosophical, Jungian, spiritual, social, etc. kind of a way when you became aware of being in some ways apart from others and the world around you.  In her 1997 paper, “The Basal Ganglia and Cognitive Pattern Generators“, Professor Ann Graybiel writes,

The link between intent and action may also have a quite specific function during development. This set of circuits may provide part of the neural mechanism for building up cognitive patterns involving recognition of the self. It is well documented that, as voluntary motor behaviors develop and as feedback about the consequences of these behaviors occurs, the perceptuomotor world of the infant develops (Gibson 1969). These same correlations among intent, action, and consequence also offer a simple way for the young organism to acquire the distinction between actively initiated and passively received events. As a result, the infant can acquire the recognition of self as actor. The iterative nature of many basal ganglia connections and the apparent involvement of the basal ganglia in some forms of learning could provide a mechanism for this development of self-awareness.

As Professor Graybiel relates the “self” to function in the basal-ganglia and the so-called cortico-thalamic basal-ganglia loops – a set of parallel circuits that help to properly filter internal mental activity into specific actions and executable decisions – I got a kick out of a paper that describes how the development of the basal-ganglia can go awry for cells that are born at certain times.

Check out the paper, “Modular patterning of structure and function of the striatum by retinoid receptor signaling” by Liao et al.   It reveals that mice who lack a certain retinoic acid receptor gene (RARbeta) have a type of defective neurogenesis in late-born cells that make up a part of the basal ganglia (striatum) known as a striosome.  Normally, the authors say, retinoic acid helps to expand a population of late-born striosomal cells, but in the RARbeta mutant mice, the rostral striosomes remain under-developed.   When given dopaminergic stimulation, these mutant mice showed slightly less grooming and more sterotypic behaviors.

So when was “my self’s” birthday?  Was it when these late-born striosomal cells were, umm, born?  Who knows, but I’m glad my retinoic acid system was intact.

Reblog this post [with Zemanta]

Read Full Post »

Diagram to illustrate Minute Structure of the ...
Image via Wikipedia

For a great many reasons, research on mental illness is focused on the frontal cortex.  Its just a small part of the brain, and certainly, many things can go wrong in other places during brain/cognitive development, but, it remains a robust finding, that when the frontal cortex is not working well, individuals have difficulties in regulating thoughts and emotions.  Life is difficult enough to manage, let alone without a well functioning frontal cortex.  So its no surprise that many laboratories look very closely at how this region develops prenatally and during childhood.

One of the more powerful genetic methods is the analysis of gene expression via microarrays (here is a link to a tutorial on this technology).  When this technology is coupled with extremely careful histological analysis and dissection of cortical circuits in the frontal cortex, it begins to become possible to begin to link changes in gene expression with the physiological properties of specific cells and local circuits in the frontal cortex. The reason this is an exciting pursuit is because the mammalian neocortex is organized in a type of layered fashion wherein 6 major layers have different types of connectivity and functionality.  The developmental origins of this functional specificity are thought to lie in a process known as radial migration (here is a video of a neuron as it migrates radially and finds its place in the cortical hierarchy).  As cells are queued out of the ventricular zone, and begin their migration to the cortical surface, they are exposed to all sorts of growth factors and morphogens that help them differentiate and form the proper connectivities.  Thus, the genes that regulate this process are of keen interest to understanding normal and abnormal cognitive development.

Here’s an amazing example of this – 2 papers entitled, “Infragranular gene expression disturbances in the prefrontal cortex in schizophrenia: Signature of altered neural development?” [doi:10.1016/j.nbd.2009.12.013] and “Molecular markers distinguishing supragranular and infragranular layers in the human prefrontal cortex [doi:10.1111/j.1460-9568.2007.05396.x] both by Dominique Arion and colleagues.  In both papers, the authors ask, “what genes are differentially expressed in different layers of the cortex?”.  This is a powerful line of inquiry since the different layers of cortex are functionally different in terms of their connectivity.  For example, layers II-III (the so-called supragranular layers) are known to connect mainly to other cortical neurons – which is different functionally than layers V-VI (the so-called infragranular layers) that connect mainly to the striatum (layer V) and thalamus (layer VI).  Thus, if there are genes whose expression is unique to a layer, then one has a clue as to how that gene might contribute to normal/abnormal information processing.

The authors hail from a laboratory that is well-known for work over many years on fine-scaled histological analysis of the frontal cortex at the University of Pittsburgh and used a method called, laser capture microdissection, where post-mortem sections of human frontal cortex (area 46) were cut to separate the infragraular layer from the supragranular layer.  The mRNA from these tissue sections was then used for DNA microarray hybridization.  Various controls, replicate startegies and in-situ tissue hybridizations were then employed to validate the initial microarray results.

In first paper, the where the authors compare infra vs. supragranular layers, they report that 40 genes were more highly expressed in the supragranular layers (HOP, CUTL2 and MPPE1 were among the most enriched) and 29 genes were highly expressed in the infragranular layers (ZNF312, CHN2, HS3ST2 were among the most enriched).  Other differentially expressed genes included several that have previously been implicated in cortical layer formation such as RLN, TLX-NR2E1, SEMA3E, PCP4, SERPINE2, NR2F2/ARP1, PCDH8, WIF1, JAG1, MBP.  Amazing!! A handful of genes that seem to label subpopulations of projection neurons in the frontal cortex.  Polymorphic markers for these genes would surely be powerful tools for imaging-genetic studies on cognitive development.

In the second paper, the authors compare infra vs. supragranular gene expression in post-mortem brains from patients with schizophrenia and healthy matched controls. Using the same methods, the team reports both supra- and infragranular gene expression changes in schizophrenia (400 & 1200 differences respectively) – more than 70% of the differences appearing to be reductions in gene expression in schizophrenia. Interestingly, the team reports that the genes that were differentially expressed in the infragranular layers provided sufficient information to discriminate between cases and controls, whilst the gene expression differences in the supragranular layers did not.  More to the point, the team finds that 51 genes that were differentially expressed in infra- vs. supragranular expression were also differentially expressed in cases vs. controls  (many of these are also found to be associated in population genetic association studies of schiz vs. control as well!).  Thus, the team has identified layer (function) -specific genes that are associated with schizophrenia.  These genes, the ones enriched in the infragranular layers especially, seem to be at the crux of a poorly functioning frontal cortex.

The authors point to 3 such genes (SEMA3E, SEMA6D, SEMA3C) who happen to members of the same gene family – the semaphorin gene family.  This gene family is very important for the neuronal guidance (during radial migration), morphology, pruning and other processes where cell shape and position are regulated.  The authors propose that the semaphorins might act as “integrators” of various forms of wiring during development and in adulthood.  More broadly, the authors provide a framework to understand how the development of connectivity on the frontal cortex is regulated by genetic factors – indeed, many suspected genetic risk factors play a role in the developmental pathways the authors have focused on.

Reblog this post [with Zemanta]

Read Full Post »

***PODCAST ACCOMPANIES THIS POST***

In his undergraduate writings while a student at Harvard in the early 1900′s E. E. Cummings quipped that, “Japanese poetry is different from Western poetry in the same way as silence is different from a voice”.  Isabelle Alfandary explores this theme in Cummings’ poetry in her essay, “Voice and Silence in E. E. Cummings’ Poetry“,  giving some context to how the poet explored the meanings and consequences of voice and silence.  Take for example, his poem “silence”

silence

.is
a
looking

bird:the

turn
ing;edge, of
life

(inquiry before snow

e.e. cummings

Lately, it seems that the brain imaging community is similarly beginning to explore the meanings and consequences of the brain when it speaks (activations whilst performing certain tasks) and when it rests quietly.  As Cummings beautifully intuits the profoundness of silence and rest,  I suppose he might have been intrigued by just how very much the human brain is doing when we are not speaking, reading, or engaged in a task. Indeed, a community of brain imagers seem to be finding that the brain at rest has quite a lot to say – moreso in people who carry certain forms of genetic variation (related posts here & here).

A paper by Perrson and colleagues “Altered deactivation in individuals with genetic risk for Alzheimer’s disease” [doi:10.1016/j.neuropsychologia.2008.01.026] asked individuals to do something rather ordinary – to pay attention to words – and later to then respond to the meaning of these words (a semantic categorization task). This simple endeavor, which, in many ways uses the very same thought processes as used when reading poetry, turns out to activate regions of the temporal lobe such as the hippocampus and other connected structures such as the posterior cingulate cortex.  These brain regions are known to lose function over the course of life in some individuals and underlie their age-related difficulties in remembering names and recalling words, etc.  Indeed, some have described Alzheimer’s disease as a tragic descent into a world of silence.

In their recordings of brain activity of subjects (60 healthy participants aged 49-79), the team noticed something extraordinary.  They found that there were differences not in how much the brain activates during the task – but rather in how much the brain de-activates – when participants simply stare into a blank screen at a small point of visual fixation.  The team reports that individuals who carry at least one copy of epsilon-4 alleles of the APOE gene showed less de-activation of their their brain (in at least 6 regions of the so-called default mode network) compared to individuals who do not carry genetic risk for Alzheimer’s disease.  Thus the ability of the brain to rest – or transition in and out of the so-called default mode network – seems impaired in individuals who carry higher genetic risk.

So, I shall embrace the poetic wisdom of E. E. Cummings and focus on the gaps, empty spaces, the vastness around me, the silences, and learn to bring my brain to rest.  And in so doing, perhaps avoid an elderly descent into silence.

***PODCAST ACCOMPANIES THIS POST***

Reblog this post [with Zemanta]

Read Full Post »

One of the complexities in beginning to understand how genetic variation relates to cognitive function and behavior is that – unfortunately – there is no gene for “personality”, “anxiety”, “memory” or any other type of “this” or “that” trait.  Most genes are expressed rather broadly across the entire brain’s cortical layers and subcortical systems.  So, just as there is no single brain region for “personality”, “anxiety”, “memory” or any other type of “this” or “that” trait, there can be no such gene.  In order for us to begin to understand how to interpret our genetic make-up, we must learn how to interpret genetic variation via its effects on cells and synapses – that go on to function in circuits and networks.  Easier said than done?  Yes, but perhaps not so intractable.

Here’s an example.  One of the most well studied circuits/networks/systems in the field of cognitive science are so-called basal-ganglia-thalamcortical loops.  These loops have been implicated in a great many forms of cognitive function involving the regulation of everything from movement, emotion and memory to reasoning ability.  Not surprisingly, neuroimaging studies on cognitive function almost always find activations in this circuitry.  In many cases, the data from neuroimaging and other methodologies suggests that one portion of this circuitry – the frontal cortex – plays a role in the representation of such aspects as task rules, relationships between task variables and associations between possible choices and outcomes.  This would be sort of like the “thinking” part of our mental life where we ruminate on all the possible choices we have and the ins and outs of what each choice has to offer.  Have you ever gone into a Burger King and – even though you’ve known for 20 years what’s on the menu – you freeze up and become lost in thought just as its your turn to place your order?  Your frontal cortex is at work!

The other aspect of this circuitry is the subcortical basla ganglia, which seems to play the downstream role of processing all that ruminating activity going on in the frontal cortex and filtering it down into a single action.  This is a simple fact of life – that we can be thinking about dozens of things at a time, but we can only DO 1 thing at a time.  Alas, we must choose something at Burger King and place our order.  Indeed, one of the hallmarks of mental illness seems to be that this circuitry functions poorly – which may be why individuals have difficulty in keeping their thoughts and actions straight – the thinking clearly and acting clearly aspect of healthy mental life.  Certainly, in neurological disorders such as Parkinson’s Disease and Huntington’s Disease, where this circuitry is damaged, the ability to think and move one’s body in a coordinated fashion is disrupted.

Thus, there are at least 2 main components to a complex system/circuits/networks that are involved in many aspects of learning and decision making in everyday life.  Therefore, if we wanted to understand how a gene – that is expressed in both portions of this circuitry – inflenced our mental life, we would have to interpret its function in relation to each specific portion of the circuitry.  In otherwords, the gene might effect the prefrontal (thinking) circuitry in one way and the basla-ganglia (action-selection) circuitry in a different way.  Since we’re all familiar with the experience of walking in to a Burger King and seeing folks perplexed and frozen as they stare at the menu, perhaps its not too difficult to imagine that a gene might differentially influence the ruminating process (hmm, what shall I have today?) and the action selection (I’ll take the #3 combo) aspect of this eveyday occurrance (for me, usually 2 times per week).

Nice idea you say, but does the idea flow from solid science?  Well, check out the recent paper from Cindy M. de Frias and colleagues “Influence of COMT Gene Polymorphism on fMRI-assessed Sustained and Transient Activity during a Working Memory Task.” [PMID: 19642882].  In this paper, the authors probed the function of a single genetic variant (rs4680 is the Methionine/Valine variant of the dopamine metabolizing COMT gene) on cognitive functions that preferentially rely on the prefronal cortex as well as mental operations that rely heavily on the basal-ganglia.  As an added bonus, the team also probed the function of the hippocampus – yet a different set of circuits/networks that are important for healthy mental function.  OK, so here is 1 gene who is functioning  within 3 separable (yet connected) neural networks!

The team focused on a well-studied Methionine/Valine variant of the dopamine metabolizing COMT gene which is broadly expessed across the pre-frontal (thinking) part of the circuitry and the basal-ganglia part of the circuitry (action-selection) as well as the hippocampus.  The team performed a neuroimaging study wherein participants (11 Met/Met and 11 Val/Val) subjects had to view a series of words presented one-at-a-time and respond if they recalled that a word was a match to the word presented 2-trials beforehand  (a so-called “n-back task“).  In this task, each of the 3 networks/circuits (frontal cortex, basal-ganglia and hippocampus) are doing somewhat different computations – and have different needs for dopamine (hence COMT may be doing different things in each network).  In the prefrontal cortex, according to a theory proposed by Robert Bilder and colleagues [doi:10.1038/sj.npp.1300542] the need is for long temporal windows of sustained neuronal firing – known as tonic firing (neuronal correlate with trying to “keep in mind” all the different words that you are seeing).  The authors predicted that under conditions of tonic activity in the frontal cortex, dopamine release promotes extended tonic firing and that Met/Met individuals should produce enhanced tonic activity.  Indeed, when the authors looked at their data and asked, “where in the brain do we see COMT gene associations with extended firing? they found such associations in the frontal cortex (frontal gyrus and cingulate cortex)!

Down below, in the subcortical networks, a differerent type of cognitive operation is taking place.  Here the cells/circuits are involved in the action selection (press a button) of whether the word is a match and in the working memory updating of each new word.  Instead of prolonged, sustained “tonic” neuronal firing, the cells rely on fast, transient “phasic” bursts of activity.  Here, the modulatory role of dopamine is expected to be different and the Bilder et al. theory predicts that COMT Val/Val individuals would be more efficient at modulating the fast, transient form of cell firing required here.   Similarly, when the research team explored their genotype and brain activity data and asked, “where in the brain do we see COMT gene associations with transient firing? they found such associations in the right hippocampus.

Thus, what can someone who carries the Met/Met genotype at rs4680 say to their fellow Val/Val lunch-mate next time they visit a Burger King?  “I have the gene for obesity? or impulsivity? or “this” or “that”?  Perhaps not.  The gene influences different parts of each person’s neural networks in different ways.  The Met/Met having the advantage in pondering (perhaps more prone to annoyingly gaze at the menu forever) whist the Val/Val has the advantage in the action selecting (perhaps ordering promptly but not getting the best burger and fries combo).

Reblog this post [with Zemanta]

Read Full Post »

Just a pointer to onetime University of Edinburgh Professor C.H. Waddington’s 1972 Gifford Lecture on framing the genes vs. environment debate of human behavior.  Although Waddington is famous for his work on population genetics and evolutionary change over time, several of his concepts are experiencing some resurgence in the neuroimaging and psychological development literatures these days.

One term, CHREOD, combines the Greek word for “determined” or “necessary” and the word for “pathway.” It describes a system that returns to a steady trajectory in contrast to homeostasis which describes a system which returns to a steady state.  Recent reviews on the development of brain structure have suggested that the “trajectory” (the actual term “chreod” hasn’t survived) as opposed to any specific time point is the essential phenotype to use for understanding how genes relate to psychological development.  Another term, CANALIZATION, refers to the ability of a population to produce the same phenotype regardless of variability in its environment or genotype.  A recent neonatal twin study found that the heritability of grey matter in neonatal humans was rather low.  However it seems to then rise until young adulthood – as genetic programs presumably kick-in – and then decline again.  Articles by neurobiologist Jay N. Giedd and colleagues have suggested that this may reflect Waddington’s idea of canalization.  The relative influence of genes vs. environment may change over time in ways that perhaps buffer against mutations and/or environmental insults to ensure the stability and robustness of functions and processes that are both appropriate for survival and necessary for future development.  Another Waddington term, EPIGENETIC LANDSCAPE, refers to the limitations on how much influence genes and environment can have on the development of a given cell or structure.  Certainly the environment can alter the differentiation, migration, connectivity, etc. of neurons by only so much.  Likewise, most genetic mutations have effects that are constrained or compensated for by the larger system as well.

Its amazing to me how well these evolutionary genetic concepts capture the issues at the nexus of of genetics and cognitive development.  From his lecture, it is clear that Waddington was not unaware of this.  Amazing to see a conceptual roadmap laid out so long ago.  Digging the book cover art as well!

Reblog this post [with Zemanta]

Read Full Post »

We hope, that you choke, that you choke.
Image by Corrie… via Flickr

Coping with fear and anxiety is difficult.  At times when one’s life, livelihood or loved one’s are threatened, we naturally hightenen our senses and allocate our emotional and physical resources for conflict.  At times, when all is well, and resources, relationships and relaxation time are plentiful, we should unwind and and enjoy the moment.  But most of us don’t.  Our prized cognitive abilities to remember, relive and ruminate on the bad stuff out there are just too well developed – and we suffer – some more than others  (see Robert Saplosky’s book “Why Zebras Don’t Get Ulcers” and related video lecture (hint – they don’t get ulcers because they don’t have the cognitive ability to ruminate on past events).  Such may be the flip side to our (homo sapiens) super-duper cognitive abilities.

Nevertheless, we try to understand our fears and axieties and understand their bio-social-psychological bases. A recent paper entitled, “A Genetically Informed Study of the Association Between Childhood Separation Anxiety, Sensitivity to CO2, Panic Disorder, and the Effect of Childhood Parental Loss” by Battaglia et al. [Arch Gen Psychiatry. 2009;66(1):64-71] brought to mind many of the complexities in beginning to understand the way in which some individuals come to suffer more emotional anguish than others.  The research team addressed a set of emotional difficulties that have been categorized by psychiatrists as “panic disorder” and involving sudden attacks of fear, sweating, racing heart, shortness of breath, etc. which can begin to occur in early adulthood.

Right off the bat, it seems that one of the difficulties in understanding such an emotional state(s) are the conventions (important for $$ billing purposes) used to describe the relationship between “healthy” and “illness” or “disorder”.  I mean, honestly, who hasn’t experienced what could be described as a mild panic disorder once or twice?  I have, but perhaps that doesn’t amount to a disorder.  A good read on the conflation of normal stress responses and disordered mental states is “Transforming Normality into Pathology: The DSM and the Outcomes of Stressful Social Arrangements” by Allan V. Horwitz.

Another difficulty in understanding how and why someone might experience such a condition has to do with the complexities of their childhood experience (not to mention genes). Child development and mental health are inextrictably related, yet, the relationship is hard to understand.  Certainly, the function of the adult brain is the product of countless developmental unfoldings that build upon one another, and certainly there is ample evidence that when healthy development is disrupted in a social or physical way, the consequences can be very unfortunate and long-lasting. Yet, our ability to make sense of how and why an individual is having mental and/or emotional difficulty is limited.  Its a complex, interactive and emergent set of processes.

What I liked about the Battaglia et al., article was the way in which they acknowledged all of these complexities and – using a multivariate twin study design – tried to objectively measure the effects of genes and environment (early and late) as well as candidate biological pathways (sensitivity to carbon dioxide).  The team gathered 346 twin pairs (equal mix of MZ and DZ) and assessed aspects of early and late emotional life as well as the sensitivity to the inhalation of 35% CO2 (kind of feels like suffocating and is known to activate fear circuitry perhaps via the ASC1a gene).   The basic notion was to parcel out the correlations between early emotional distress and adult emotional distress as well as with a very specific physiological response (fear illicited by breathing CO2).  If there were no correlation or covariation between early and late distress (or the physiological response) then perhaps these processes are not underlain by any common mechanism.

However, the team found that there was covariation between early life emotion (criteria for separation anxiety disorder) and adult emotion (panic disorder) as well as the physiological/fear response illicited by CO2.  Indeed there seems to be a common, or continuous, set of processes whose disruption early in development can manifest as emotional difficulty later in development.  Furthermore, the team suggests that the underlying unifying or core process is heavily regulated by a set of additive genetic factors.  Lastly, the team finds that the experience of parental loss in childhood increased (but not via an interaction with genetic variation) the strength of the covariation between early emotion, late emotion and CO2 reactivity.  The authors note several limitations and cautions to over-interpreting these data – which are from the largest such study of its kind to date.

For individuals who are tangled in persistent ruminations and emotional difficulties, I don’t know if these findings help.  They seem to bear out some of the cold, cruel logic of life and evolution – that our fear systems are great at keeping us alive when we’ve had adverse experience in childhood, but not necessarily happy.  On the other hand, the covariation is weak, so there is no such destiny in life, even when dealt unfortunate early experience AND genetic risk.  I hope that learning about the science might help folks cope with such cases of emotional distress.

Reblog this post [with Zemanta]

Read Full Post »

DON’T tell the grant funding agencies, but, in at least one way, the effort to relate genetic variation to individual differences in cognitive function is a totally intractable waste of money.

Let’s say we ask a population of folks to perform a task – perhaps a word memory task – and then we use neuroimaging to identify the areas of the brain that (i) were associated with performance of the task, and (ii) were not only associated with performance, but were also associated with genetic variation in the population.  Indeed, there are already examples of just this type of “imaging-genetic” study in the literature.  Such studies form a crucial translational link in understanding how genes (whose biochemical functions are most often studied in animal models) relate to human brain function (usually studied with cognitive psychology). However, do these genes relate to just this task? What if subjects were recalling objects? or feelings?  What if subjects were recalling objects / experiences / feelings / etc. from their childhoods?  Of course, there are thousands of common cognitive operations one’s brain routinely performs, and, hence, thousands of experimental paradigms that could be used in such “imaging-genetic” gene association studies.  At more than $500/hour (some paradigms last up to 2 hours) in imaging costs, the translational genes-to-cognition endeavor could get expensive!

DO tell the grant funding agencies that this may not be a problem any longer.

The recent paper by Liu and colleagues “Prefrontal-Related Functional Connectivities within the Default Network Are Modulated by COMT val158met in Healthy Young Adults” [doi: 10.1523/jneurosci.3941-09.2010] suggests an approach that may simplify matters.  Their approach still involves genotyping (in this case for rs4680) and neuroimaging.  However, instead of performing a specific cognitive task, the team asks subjects to lay in the scanner – and do nothing.  That’s right – nothing – just lay still with eyes closed and just let the mind wander and not to think about anything in particular – for a mere 10 minutes.  Hunh?  What the heck can you learn from that?

It turns out that one can learn a lot.  This is because the neural pathways that the brain uses when you are actively doing something (a word recall task) are largely intact even when you are doing nothing.  Your brain does not “turn off” when you are laying still with your eyes closed and drifting in thought.  Rather, your brain slips into a kind of default pattern, described in studies of  “default networks” or “resting-state networks” where wide-ranging brain circuits remain dynamically coupled and actively exchange neural information.  One really great paper that describes these networks is a free-and-open article by Hagmann et al., “Mapping the Structural Core of Human Cerebral Cortex” [doi: 10.1371/journal.pbio.0060159] from which I’ve lifted their Figure 1 above.  The work by Hagmann et al., and others show that the brain has a sort of “connectome” where there are thousands of “connector hubs” or nodes that remain actively coupled (meaning that if one node fires, the other node will fire in a synchronized way) when the brain is at rest and when the brain is actively performing cognitive operations.  In a few studies, it seems that the strength of functional coupling in certain brain areas at rest is correlated (positively and negatively) with the activation of these areas when subjects are performing a specific task.

In the genetic study reported by Liu and colleagues, they found that genotype (N=57) at the dopaminergic COMT gene correlated with differences in the functional connectivity (synchronization of firing) of nodes in the prefrontal cortex.  This result is eerily similar to results found for a number of specific tasks (N-back, Wisconsin Card Sorting, Gambling, etc.) where COMT genotype was correlated with the differential activation of the frontal cortex during the task.  So it seems that one imaging paradigm (lay still and rest for 10 minutes) provided comparable insights to several lengthy (and diverse) activation tasks.  Perhaps this is the case. If so, might it provide a more direct route to linking genetic variation with cognitive function?

Liu and colleagues do not comment on this proposition directly nor do they seem to be over-interpreting their results in they way I have editorialized things here.  They very thoughtfully point out the ways in which the networks they’ve identified and similar and different to the published findings of others.  Certainly, this study and the other one like it are the first in what might be a promising new direction!

Reblog this post [with Zemanta]

Read Full Post »

Some quick sketches that might help put the fast-growing epigenetics and cognitive development literature into context.  Visit the University of Utah’s Epigenetics training site for more background!

The genome is just the A,G,T,C bases that encode proteins and other mRNA molecules.  The “epi”genome are various modification to the DNA – such as methylation (at C residues) – and acetylation of histone proteins.   These changes help the DNA form various secondary and tertiary structures that can facilitate or block the interaction of DNA with the transcriptional machinery.

When DNA is highly methylated, it generally is less accessible for transcription and hence gene expression is reduced.  When histone proteins (purple blobs that help DNA coil into a compact shape) are acetylated, the DNA is much more accessible and gene expression goes up.

We know that proper epigenetic regulation is critical for cognitive development because mutations in MeCP2 – a protein that binds to methylated C residues – leads to Rett syndrome.  MeCP2 is normally responsible for binding to methylated DNA and recruiting histone de-acetylases (HDACs) to help DNA coil and condense into a closed form that is inaccessible for gene expression (related post here).

When DNA is accessible for gene expression, then it appears that – during brain development – there are relatively more synaptic spines produced (related post here).  Is this a good thing? Rett syndrome would suggest that – NO – too many synaptic spines and too much excitatory activity during brain development may not be optimal.  Neither is too little excitatory (too much inhibitory) activity and too few synaptic spines.  It is likely that you need just the right balance (related post here). Some have argued (here) that autism & schizophrenia are consequences of too many & too few synapses during development.

The sketch above illustrates a theoretical conjecture – not a scenario that has been verified by extensive scientific study. It tries to explain why epigenetic effects can, in practice, be difficult to disentangle from true (changes in the A,G,T,C sequence) genetic effects.  This is because – for one reason – a mother’s experience (extreme stress, malnutrition, chemical toxins) can – based on some evidence – exert an effect on the methylation of her child’s genome.  Keep in mind, that methylation is normal and widespread throughout the genome during development.  However, in this scenario, if the daughter’s behavior or physiology were to be influenced by such methylation, then she could, in theory, when reaching reproductive age, expose her developing child to an environment that leads to altered methylation (shown here of the grandaughter’s genome).  Thus, an epigenetic change would look much like there is a genetic variant being passed from one generation to the next, but such a genetic variant need not exist (related post here, here) – as its an epigenetic phenomenon.  Genes such as BDNF have been the focus of many genetic/epigenetic studies (here, here) – however, much, much more work remains to determine and understand just how much stress/malnutrition/toxin exposure is enough to cause such multi-generational effects.  Disentangling the interaction of genetics with the environment (and its influence on the epigenome) is a complex task, and it is very difficult to prove the conjecture/model above, so be sure to read the literature and popular press on these topics carefully.

Reblog this post [with Zemanta]

Read Full Post »

The recent paper, “Comparative genomics of autism and schizophrenia” by Bernard Crespi and colleagues provides a very exciting take on how genetic data can be mined to understand cognitive development and mental illness.  Looking at genetic association data for autism and schizophrenia, the authors point out that 4 loci are associated with both schizophrenia and autism – however, with a particular twist.  In the case of 1q21.1 and 22q11.21 it seems that genetic deletions are associated with schizophrenia while duplications at this locus are associated with autism.  At 16p11.2 and 22q13.3  it seems that duplications are associated with schizophrenia and deletions are associated with autism.  Thus both loci contain genes that regulate brain development such that too much (duplication) or too little (deletion) of these genes can cause brain development to go awry.  The authors point to genes involved in cellular and synaptic growth for which loss-of-function in growth inhibition genes (which would cause overgrowth) have been associated with autism while loss-of-function in growth promoting genes (which would cause undergrowth) have been associated with schizophrenia.  Certainly there is much evidence for overproduction of synapses in the autism-spectrum disorders and loss of synapses in schizophrenia.  Crespi et al., [doi:10.1073/pnas.0906080106]

Other research covered (here, here) demonstrates the importance of the proper balance of excitatory and inhibitory signalling during cortical development.

Reblog this post [with Zemanta]

Read Full Post »

Surgeon holding scalpel.
Image by bethd821 via Flickr

Whether you are a carpenter, plumber, mechanic, electrician, surgeon or chef, your livelihood depends on a set of sturdy, reliable, well-honed, precision tools.  Similarly, neuroscientists depend on their electrodes, brain scanners, microscopes and more recently their genome sequencers.  This is because they are not just trying to dissect the brain – the physical organ – but also the psychological one.  As the billions of neurons connected by trillions of synapses process electrical impulses – a kind of neural information – it is the great endeavor of cognitive-molecular-neuro-psychology (or whatever you wish to call the art) to figure out how all of those neurons and connections come into being and how they process information in ways that lead to your personality, self-image, hopes, dreams, memories and the other wonderful aspects of your mental life.  How and why does information flow through the brain in the way it does? and how and why does it do so in different ways for different people? Some, for instance, have informally related Sigmund Freud‘s models of mental structure to a kind of plumbing wherein psychic energy was routed (or misrouted) through different structural aspects of the mind (pipes as it were).  Perhaps such a model was fitting for the great industrial era in which he lived – but perhaps not in today’s highly information-based, inter-connected and network-oriented era.  If our understanding of mental life is a product of our tools, then perhaps we should be sure that our modern tools are up to the job.

One recent paper reminded me of how important it is to double check the accuracy and precision of one’s tools was the research article, “Quantifying the heritability of task-related brain activation and performance during the N-back working memory task: A twin fMRI study” [doi:10.1016/j.biopsycho.2008.03.006] by Blokland et al..  In this report, the team summarizes the results of measurments of the brain activity – not structure – but rather activity as measured by their chosen tool, the MRI scanner.  This research team, based in UCLA and known as one of the best in the field, asks whether the so-called BOLD response (an indirect measure of neural activity) shows greater concordance in identical (monozygotic) vs. fraternal (dizygotic) twins.  To generate brain activity, the research team asked the subjects to perform a task called an N-back  workng memory task, which entails having to remember something that happend “N” times ago (click here for further explanation of N-back task or play it on your iphone).  If you’ve done this, you’ll know that its hard – maddeningly so – and it requires a lot of concentration, which, the researchers were counting on to generate activity in the prefrontal cortex.

After looking at the brain activity patterns of some 29 MZ pairs and 31 DZ pairs, the team asked if the patterns of brain activity in the lateral frontal cortex were more similar in the MZ pairs vs. the DZ pairs.  If so, then it would suggest that the scanning technology (measurement of the BOLD response) is sufficiently reliable and precise enough to detect the fraction of individual differences in brain activty that arise from additive genetic variation.  If one actually had such super-precise tool, then one could begin to dissect and tease apart aspects of human cognition that are regulated by individual genetic variation – a very super-precise and amazing tool – that might allow us to understand mental life in biologically-based terms (and not Freud’s plumbingesque analogies).  If only such a tool existed! Somewhat amazingly, the scanning tools did seem to be able to detect differences between the BOLD response correlations of MZ pairs vs. DZ pairs.  The BOLD response correlations were greater for MZ vs. DZ in the middle frontal gyrus, angular gyrus, supramarginal gyrus when activity for the 2-back task was compared to the 0-back task.  The team were cautious to extend these findings too far, since the standard deviations are large and the estimates of heritability for the BOLD response are rather low (11-36%), but, overall, the team suggests that the ability to use the fMRI methods in conjunction with genetic markers shows future promise.

Meanwhile, the literature of so-called “imaging-genetic” findings begins to grow in the literature.  I hope the tools are reliable and trustworthy enough to justify conclusions and lessons about human genetic variation and its role in mental life.  Will certainly keep this cautionary report in mind as I report on the cognitive genetics literature in the future.

Reblog this post [with Zemanta]

Read Full Post »

MFrankIf you’re interested in the neurobiology of learning and decision making, then you might be interested in this brief interview with Professor Michael Frank who runs the Laboratory of Neural Computation and Cognition at Brown University.

From his lab’s website: “Our research combines computational modeling and experimental work to understand the neural mechanisms underlying reinforcement learning, decision making and working memory. We develop biologically-based neural models that simulate systems-level interactions between multiple brain areas (primarily basal ganglia and frontal cortex and their modulation by dopamine). We test theoretical predictions of the models using various neuropsychological, pharmacological, genetic, and neuroimaging techniques.”

In this interview, Dr. Frank provides some overviews on how genetics fits into this research program and the genetic results in his recent research article “Prefrontal and striatal dopaminergic genes predict individual differences in exploration and exploitation”. Lastly, some lighthearted, informal thoughts on the wider implications and future uses of genetic information in decision making.

To my mind, there is no one else in the literature who so seamlessly and elegantly interrelates genetics with the modern tools of cognitive science and computational neurobiology.  His work really allows one to cast genetic variation in terms of its influence on neural computation – which is the ultimate way of understanding how the brain works.  It was a treat to host this interview!

Click here for the podcast and here, here, here for previous blog posts on Dr. Frank’s work.

Reblog this post [with Zemanta]

Read Full Post »

A column of the cortex
Image by Ethan Hein via Flickr

Here’s a new addition to a rapidly growing list of findings for the valine-to-methionine substitution in the COMT gene (rs4680).  The paper, “Effects of the Val158Met catechol-O-methyltransferase polymorphism on cortical structure in children and adolescents” by Shaw and colleagues at the NIMH [doi:10.1038/mp.2008.121] finds that when genotype was used as a regressor for cortical thickness measures in children (8-14 years of age) significant associations were found in the right inferior frontal gyrus and the right superior/middle temporal gyrus (in both areas, the met/met group had thicker cortex).  The team notes that the findings in the frontal cortex were expected – as many others have found associations of COMT with this brain area using other imaging modalities.  However, the temporal lobe finds are something new.  No speculations on the mechanisms/implications are provided by the researchers on this new finding, but known interconnectivities of these two brain regions exist – perhaps supporting aspects of language, memory and/or other cognitive processes?

Perhaps the findings provide a clue to an important role that genes may play in the development of cognitive function.

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »

Follow

Get every new post delivered to your Inbox.

Join 30 other followers