Feeds:
Posts
Comments

Posts Tagged ‘Depression’

Modified drawing of the neural circuitry of th...
Image via Wikipedia

You already know this, but when you are stressed out (chronic stress), your brain doesn’t work very wellThat’s right – just when you need it most – your brain has a way of letting you down!

Here are a few things that happen to the very cells (in the hippocampus) that you rely on:

- reorganization within mossy fiber terminals
- loss of excitatory glutamatergic synapses
- reduction in the surface area of postsynaptic densities
- marked retraction of thorny excrescences
- alterations in the lengths of the terminal dendritic segments of pyramidal cells
- reduction of the dorsal anterior CA1 area volume

Thanks brain!  Thanks neurons for abandoning me when I need you most!  According to this article, these cellular changes lead to, “impaired hippocampal involvement in episodic, declarative, contextual and spatial memory – likely to debilitate an individual’s ability to process information in new situations and to make decisions about how to deal with new challenges.” UGH!

Are our cells making these changes for a reason?  Might it be better for cells to remodel temporarily rather than suffer permanent, life-long damage?  Perhaps.  Perhaps there are molecular pathways that can lead the reversal of these allostatic stress adaptations?

Check out this recent paper: “A negative regulator of MAP kinase causes depressive behavior” [doi 10.1038/nm.2219]  the authors have identified a gene – MKP-1 – a phosphatase that normally dephosphorylates various MAP kinases involved in cellular growth, that, when inactivated in mice, produces animals that are resistant to chronic unpredictable stress.  Although its known that MKP-1 is needed to limit immune responses associated with multi-organ failure during bacterial infections, the authors suggest:

“pharmacological blockade of MKP-1 would produce a resilient of anti-depressant response to stress”

Hmmm … so Mother Nature is using the same gene to regulate the immune response (turn it off so that it doesn’t damage the rest of the body) and to regulate synaptic growth (turn it off – which is something we DON’T want to do when we’re trying to recover from chronic stress)?  Mother Nature gives us MKP-1 so I can survive an infection, but the same gene prevents us from recovering (finding happiness) from stress?

Of course, we do not need to rely only on pharmacological solutions.  Exercise & social integration are cited by these authors as the top 2 non-medication strategies.

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Corticotropin-releasing hormone
Image via Wikipedia

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension“  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar

Reblog this post [with Zemanta]

Read Full Post »

Twin studies have long suggested that genetic variation is a part of healthy and disordered mental life.  The problem however – some 10 years now since the full genome sequence era began – has been finding the actual genes that account for this heritability.

It sounds simple on paper – just collect lots of folks with disorder X and look at their genomes in reference to a demographically matched healthy control population.  Voila! whatever is different is a candidate for genetic risk.  Apparently, not so.

The missing heritability problem that clouds the birth of the personal genomes era refers to the baffling inability to find enough common genetic variants that can account for the genetic risk of an illness or disorder.

There are any number of reasons for this … (i) even as any given MZ and DZ twin pair shares genetic variants that predispose them toward the similar brains and mental states, it may be the case that different MZ and DZ pairs have different types of rare genetic variation thus diluting out any similar patterns of variation when large pools of cases and controls are compared …  (ii) also, the way that the environment interacts with common risk-promoting genetic variation may be quite different from person to person – making it hard to find variation that is similarly risk-promoting in large pools of cases and controls … and many others I’m sure.

One research group recently asked whether the type of common genetic variation(SNP vs. CNV) might inform the search for the missing heritability.  The authors of the recent paper, “Genome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls” [doi:10.1038/nature08979] looked at an alternative to the usual SNP markers – so called common copy number variants (CNVs) – and asked if these markers might provide a stronger accounting for genetic risk.  While a number of previous papers in the mental health field have indeed shown associations with CNVs, this massive study (some 3,432 CNV probes in 2000 or so cases and 3000 controls) did not reveal an association with bipolar disorder.  Furthermore, the team reports that common CNV variants are already in fairly strong linkage disequilibrium with common SNPs and so perhaps may not have reached any farther into the abyss of rare genetic variation than previous GWAS studies.

Disappointing perhaps, but a big step forward nonetheless!  What will the personal genomes era look like if we all have different forms of rare genetic variation?

Reblog this post [with Zemanta]

Read Full Post »

Just a pointer to a great book – The Loss of Sadness: How Psychiatry Transformed Normal Sorrow into Depressive Disorder by Allan V. Horwitz and Jerome C. Wakefield.  Its an in-depth treatment on the many reasons and contexts in which we – quite naturally – feel sad and depressed and the way in which diagnostic criteria can distort the gray area between normal sadness and a psychiatric disorder.  I really enjoyed the developmental perspective on the natural advantages of negative emotions in childhood (a signal to attract caregivers) as well as the detailed evolution of the DSM diagnostic criteria.  The main gist of the book is that much of what psychiatrists treat as emotional disorders are more likely just the natural responses to the normal ups and downs of life – not disorders at all.  A case for American consumers as pill-popping suckers to medical-pharma-marketing overreach (here’s a related post on this overreach notion pointing to the work of David Healy).

Reading the book makes me feel liberated from the medical labels that are all too readily slapped on healthy people.  There is much that is healthy about sadness and many reasons and contexts in which its quite natural.  From now on, instead of trying to escape from, or rid myself of sadness, I will embrace it and let myself feel it and work through it.  Who knows, maybe this is a good first step in a healthy coping process.

If depressed emotional states are more a part of the normal range of emotions (rather than separate disordered states) then does this allow us to make predictions about the underlying genetic bases for these states?    Perhaps not.   However, on page 172, the authors apply their critical view to the highly cited Caspi et al., article (showing that 5HTT genotype interacts with life stress in the presentation of depressive illness – critiqued here).  They note that the incidence of depression at 17% in the sample is much too high – most certainly capturing a lot of normal sadness.  Hence, the prevalent short allele in the 5HTT promoter might be better thought of as a factor that underlies how healthy people respond to social stress – rather than as a drug target or risk factor for psychiatric illness.

Reblog this post [with Zemanta]

Read Full Post »

Crocus (cropped)
Image by noahg. via Flickr

If you’ve started to notice the arrival of spring blossoms, you may have wondered, “how do the blossoms know when its spring?“  Well, it turns out that its not the temperature, but rather, that plants sense the length of the day-light cycle in order to synchronize their  own life cycles with the seasons.  According to the photoperiodism entry for wikipedia, “Many flowering plants use a photoreceptor protein, such as phytochrome or cryptochrome, to sense seasonal changes in night length, or photoperiod, which they take as signals to flower.”

It turns out that humans are much the same. Say wha?!

Yep, as the long ago descendants of single cells who had to eek out a living during day (when the sun emits mutagenic UV radiation) and night cycles, our very own basic molecular machinery that regulates the transcription, translation, replication and a host of other cellular functions is remarkably sensitive – entrained – in a clock-like fashion to the rising and setting sun.  This is because, in our retinas, there are light-sensing cells that send signals to the suprachiasmatic nucleus (SCN) which then – via the pineal gland – secretes systemic hormones such as melatonin that help synchronize cells and organs in your brain and body.  When this process is disrupted, folks can feel downright lousy, as seen in seasonal affective disorder (SAD), delayed sleep phase syndrome (DSPS) and other circadian rhythm disorders.

If you’re skeptical, consider the effects of genetic variation in genes that regulate our circadian rhythms, often called “clock” genes – very ancient genes that keep our cellular clocks synchronized with each other and the outside environment.  Soria et al., have a great paper entitled, “Differential Association of Circadian Genes with Mood Disorders: CRY1 and NPAS2 are Associated with Unipolar Major Depression and CLOCK and VIP with Bipolar Disorder” [doi: 10.1038/npp.2009.230] wherein they reveal that normal variation in these clock genes is associated with mood regulation.

A few of the highlights reported are rs2287161 in the CRY1 gene,  rs11123857 in the NPAS2 gene, and rs885861 in the VIPR2 gene – where the C-allele, G-allele and C-allele, respectively, were associated with mood disorders.

I’m not sure how one would best interpret genetic variation of such circadian rhythm genes.  Perhaps they index how much a person’s mood could be influenced by changes or disruptions to the normal rhythm??  Not sure.  My 23andMe data shows the non-risk AA genotype for rs11123857 (the others are not covered by 23andMe).

Reblog this post [with Zemanta]

Read Full Post »

Eight women representing prominent mental diag...
Image via Wikipedia

pointer to symptommedia.org – fantastic video resource of specific symptoms of mental illness.

“The intention of these clips are to be used in the classroom setting as visual compliments to the written description of symptoms for psychological phenomena found in the DSM handbook.”

Reblog this post [with Zemanta]

Read Full Post »

Gravestone of Samuel Coleridge-Taylor,Wallington
Image by sludgegulper via Flickr

Few events are as hard to understand as the loss of a loved one to suicide – a fatal confluence of factors that are oft scrutinized – but whose analysis can provide little comfort to family and friends.  To me, one frightening and vexing aspect of what is known about the biological roots of depression, anxiety, impulsivity and other mental traits and states associated with suicide, is the way in which early life (even prenatal) experience can influence events in later life.  As covered in this blog here and here, there appear to be very early interactions between emotional experience in early life and the methylation of specific points in the genome.  Such methylation – often referred to as epigenetic marks – can regulate the expression of genes that are important for synaptic plasticity and cognitive development.

The recent paper, “Alternative Splicing, Methylation State, and Expression Profile of Tropomyosin-Related Kinase B in the Frontal Cortex of Suicide Completers” is a recent example of a link between epigenetic marks and suicide.  The team of Ernst et al., examined gene expression profiles from the frontal cortex and cerebellum of 28 males lost to suicide and 11 control, ethnically-matched control participants.  Using a subject-by-subject comparison method described as “extreme value analysis” the team identified 2 Affymetrix probes: 221794_at and 221796_at – that are specific to NTRK2 (TRKB) gene – that showed significantly lower expression in several areas of the frontal cortex.  The team also found that these probes were specific to exon 16 – which is expressed only in the TRKB.T1 isoform that is expressed only in astrocytes.

Further analysis showed that there were no genetic differences in the promoter region of this gene that would explain the expression differences, but, however, that there were 2 methylation sites (epigenetic differences) whose methylation status correlated with expression levels (P=0.01 and 0.004).  As a control, the DNA-methylation at these sites was not correlated with TRKB.T1 expression when DNA and RNA was taken from the cerebellum (a control since the cerebellum is not thought to be directly involved in the regulation of mood).

In the case of TRKB.T1 expression, the team reports that more methylation at these 2 sites in the promoter region is associated with less TRKB.T1 expression in the frontal cortex.  Where and when are these marks laid down?  Are they reversible?  How can we know or suspect what is happening to our epigenome (you can’t measure this by spitting into a cup as with current genome sequencing methods)? To me, the team has identified an important clue from which such follow-up questions can be addressed.  Now that they have a biomarker, they can help us begin to better understand our complex and often difficult emotional lives within a broader biological context.

Reblog this post [with Zemanta]

Read Full Post »

Logo of the United States National Institute o...
Image via Wikipedia

Many thanks to Dr. Christina S. Barr from the National Institutes of Health/National Institute on Alcohol Abuse and Alcoholism-Laboratory of Clinical and Translational Studies, National Institutes of Health Animal Center for taking the time to comment on her team’s recent publication, “Functional CRH variation increases stress-induced alcohol consumption in primates” [doi:10.1073/pnas.0902863106] which was covered here.  On behalf of students and interested readers, I am so grateful to her for doing this!  Thank you Dr. Barr!

For readers who are unfamiliar with the extensive literature on this topic, can you give them some basic background context for the study?

“In rodents, increased CRH system functioning in parts of the brain that drive anxious responding (ie, amygdala) occurs following extended access to alcohol and causes animals to transition to the addicted state.  In rodent lines in which genetic factors drive increased CRH system functioning, those animals are essentially phenocopies of those in the post-dependent state.  We had a variant in the macaque that we expected would drive increased CRH expression in response to stress, and similar variants may exist in humans.  We, therefore, hypothesized that this type of genetic variation may interact with prior stress exposure to increase alcohol drinking.”

Can you tells us more about the experimental design strategy and methods?

“This was a study that relied on use of archived NIAAA datasets. The behavioral and endocrine data had been collected years ago, but we took a gene of interest, and determined whether there was variation. We then put a considerable amount of effort into assessing the functional effects of this variant, in order to have a better understanding of how it might relate to individual variation. We then genotyped archived DNA samples in the colony for this polymorphism.”

“I am actually a veterinarian in addition to being a neuroscientist- we have the “3 R’s”. Reduce, refine, and replace…..meaning that animal studies should involve reduced numbers, should be refined to minimize pain/distress and should be replaced with molecular studies if possible.  This is an example of how you can marry use of archived data and sophisticated molecular biology techniques/data analysis to come up with a testable hypothesis without the use of animal subjects. (of course, it means you need to have access to the datasets….;)”

How do the results relate to broader questions and your field at large?

“I became interested in this system because it is one that appears to be under intense selection.  In a wide variety of animal species, individuals or strains that are particularly stress-reactive may be more likely to survive and reproduce successfully in highly variable or stressful environments. Over the course of human evolution, however, selective pressures have shifted, as have the nature and chronicity of stress exposures.  In fact, in modern society, highly stress-reactive individuals, who are no less likely to be eaten by a predator (predation not being a major cause of mortality in modern humans), may instead be more likely to fall susceptible to various-stress related disorders, including chronic infections, diabetes, heart disease, accelerated brain aging, stress-related psychiatric disorders, and even drug and alcohol problems. Therefore, these genetic variants that are persistent in modern humans may make individuals more vulnerable to “modern problems.”

I do hope this helps. Let me know if it doesn’t, and I will try to better answer your questions.”

THANK YOU AGAIN VERY MUCH DR. BARR!!

Reblog this post [with Zemanta]

Read Full Post »

Brainstorm
Image by jurvetson via Flickr

pointer to: Computational Models of Basal Ganglia Function where Kenji Doya provides computational explanations for neuromodulators and their role in reinforcement learning. In his words, “Dopamine encodes the temporal difference error — the reward learning signal. Acetylcholine affects learning rate through memory updates of actions and rewards. Noradrenaline controls width or randomness of exploration. Serotonin is implicated in “temporal discounting,” evaluating if a given action is worth the expected reward.”

This type of amazing research provides a pathway to better understand how genes contribute to how the brain “works” as a 3-dimensional biochemical computational machine.

Reblog this post [with Zemanta]

Read Full Post »

Suicide rates by Health Service Area (HSA), 19...
Image via Wikipedia

In this podcast, Michael Corbin, founder of everyminute.org, shares some of his personal background, interests and efforts in the area of suicide prevention and mental health advocacy.

You can reach Michael via email or the website contact page.

Reblog this post [with Zemanta]

Read Full Post »

Turn and Cry
Image by allthewhile via Flickr

It is commonly known that some of us handle stress better than others.  Some can calmly accept the dire economic news of an impending layoff while others may fret incessantly day-in-and-out and endure many a sleepless night.  Why ?  What are some of the brain systems that mediate the effects of accute and chronic stress ? What genetic and environmental differences might influence the development of these systems ?

In an ongoing set of experiments, Professor Michael Meaney’s laboratory has focused on the role of the glucocorticoid receptor (GR) and its role as a feedback modulator in the so-called hypothalamic-pituitary-adrenal (HPA) axis.  A number of experiments have shown that upregulation of the GR is somewhat beneficial insofar as it dampens the deleterious rise of circulating corticosteroids during stress.  Therefore, any mechanism that downregulates or blocks the expression of GR may make it harder for a person to cope with the typical physiologic responses (increases in corticosteroids) to stressful experiences (news of a layoff).

What Professor Meaney’s lab has shown so convincingly over the past several years is that individual differences in the reactivity of the HPA system are heavily influenced by maternal and early life experience.  That is, offspring (often rat or mouse pups) who have attentive mothers who keep them warm and well groomed, have more responsive HPA systems that more readily dampen the deleterious rise of corticosteroids in response to steroids.  In some cases, the level of maternal care is enough to modify the level of CpG methylation in the promoter region of the glucocorticoid receptor.  This type of “epigenetic” form of gene regulation is a way in which the promoter region can be altered in a long-term manner given a particular early-life experience.  Unfortunately, this type of epigenetic mark, can lead to life-long difficulty in managing stress.

Their recent paper, “Epigenetic regulation of the glucocorticoid receptor in human brain associates with child abuse” [doi 10.1038/nn.2270]  explores the extent of CpG methylation in post-mortem tissue (hippocampus) from 24 individuals who tragically passed away in completion of suicide.  The research team compared the levels of methylation (via bisulfite mapping) in the GR promoter region and found that there was significantly more methylation in (n=12) individuals who had a recorded history of childhood abuse (sexual contact, severe physical abuse and/or severe neglect) as compared to (n=12) individuals with no history of abuse (their CpG levels were not distinguishable from control tissue).  Thus (as confirmed by qRT-PCR) it seems as if epigenetic marks were visible in the genomes of hippocampal cell nuclei – which may have very well been written during early childhood trauma – and may have exacerbated the difficulties these individuals may have had in coping with psychosocial stress.

Further studies conducted by the team evaluate the possibility that the sites of abuse-induced-CpG methylation have the effect of blocking the binding of the EGR1 transcription factor which provides an additional mechanistic part in a larger complex of proteins that transduce the effects of experience into long-lasting behavioral predispositions.

For more on the exciting rise of epigenetics and its role in nature-meets-nuture and cognitive development click here.

Reblog this post [with Zemanta]

Read Full Post »

Yankee Doodle
Image via Wikipedia

Commuting to work is a total drag.  Commuting to work in New York City is not just a total drag, but THE definitive commuting nightmare.  Still, when one ponders the masses of people (more than 2 million each day) who tread in, out and around Manhattan, its pretty remarkable that one can get in to work and home again.

Consider then, the human brain, with 100 billion neuons and 1,000 trillion synapses – all of which need constant tender loving care and maintenance to keep firing along.  In some cases, the commute to these synapses can be quite long – even for a molecule (eg. if a motor neuron were as wide as my car, the commute from the nucleus to the presynaptic membrane would be about 10 miles, which is about how long I must travel to get to work).  Is the brain better able to transport cargo from home (the nucleus where lots of the basic materials are produced) to work (synaptic membranes which carry out information transfer) ?

I certainly hope so.  But, like my own commute, it seems the human brain can have commuting nightmares of its own.  One of the main transport vehicles in the brain is a molecule called Kinesin which literally walks (see the movie below) along microtubule tracks and delivers its cargo in little molecular satchels called protein transport vessicles.  One of the components of these transport vessicles, a protein known as piccolo,  is expressed in presynaptic zones and may be important for recycling presynaptic vessicles – as well as mental health.

Indeed, what might happen if the normal process of vessicle transport and synaptic maintenance were disrupted in the brain – a commuting debacle of sorts ? Well, Sullivan and colleagues [doi: 10.1038/mp.2008.125] report that a genome-wide association study of major depressive disorder yields piccolo (PCLO) as one of its major findings.  The single nucleotide polymorphism rs2522833, which encodes a serine to alanine substitution near the calcium binding region (amino acid #4814) of PCLO was one of the most significant findings in the original study and a follow-up of a different case/control population study on major depressive disorder. The change from alanine to serine is notable, since the addition of N-acetylglucosamine to serine residues is a common mechanism for regulating intracellular traffic.

My 23andMe profile shows an AA for this site, which is the serine/serine form of PCLO (the form which can be modified by GlcNA  -yay!) rather than the alanine/alanine form. This (A) allele is indicated as the major allele by the authors although the AA genotype is less common among individuals of European and Asian ethnicity, but quite common in sub-Saharan Africa.  The authors don’t reveal which allele is associated with an increased risk of depression, but I already know the answer – I’ll never recover from the depression of my own commuting nightmare.

Reblog this post [with Zemanta]

Read Full Post »

U.S.

Image via Wikipedia

re-posting from NARSAD news … FDA approves an amazing new form of non-invasive magnetic brain stimulation for treatment resistant depression.

Great video demonstrates the methodology and its ability to interfere with neural processing with a high degree of temporal and spatial specificity.  A new treatment that one day might be guided by genomic markers ? Perhaps.

Reblog this post [with Zemanta]

Read Full Post »

Oil on canvasImage via Wikipedia The recent paper, “Genetic Markers of Suicidal Ideation Emerging During Citalopram Treatment of Major Depression” finds that among 68 candidate genes, markers for 2 AMPA-type glutamate receptors (rs4825476, rs2518224: GRIA3 and GRIK2) show significant association in 120 individuals who experienced suicidal ideation in a large medication trial for major depressive disorder. Many families with loved ones suffering from depression remain wary and confused about a possible causal relationship between selective serotonin reuptake inhibitor (SSRI) antidepressants and suicide. A current FDA-mandated black box warning advises youths on the potential risks. This recent genetic study seems to provide a meaningful step forward in better understanding the mechanism of shifts in mood and cognition that occur in some individuals. But like many brain research studies though, shining a tiny ray of light on a puzzle suddenly illuminates massive complexities, previously unseen. A great deal of research shows that SSRI exposure leads to long lasting changes in AMPA receptor expression, localization and function, – but it’s unclear where a specific link between this and changes in mood and cognition will be drawn.

Reblog this post [with Zemanta]

Read Full Post »

United States Supreme Court
Image by onecle via Flickr

I much enjoyed the June 15th podcast “Blame it on my genes” hosted at the New York Academy of Sciences. Here, Professor Paul Appelbaum lays out a biological framework for behavioral genetics wherein genes influence an individual’s sensitivity to experience in ways that predispose or insulate them from illness. As the basic science begins to map specific (gene x environment) examples, how, then, might this knowledge play out in the justice system where it could be used in “determinations of culpability?” Indeed, as covered by Professor Appelbaum, our justice system allows individuals to be excused from culpability when they are incapacitated (insanity defense) or via automatism (a sleepwalker commits a crime but is not consciously aware of it). Can, or should, genetic background be used in this way (a genetic determinism defense)? Professor Appelbaum reviews a key Supreme Court ruling from “Robinson v. California” citing the opinions of Justice Hugo Black that recognize that just because someone is influenced by causal factors, does not mean that that person cannot choose rationally. This opinion is based on the principle of compatibilism (free will and determinism are compatible) which apparently is rooted in an ancient school of Greek philosophers. Nevertheless, there is a lot of action in the lower courts where genetic evidence is being proffered to mitigate or lessen culpability – interesting times ahead. Perhaps the judiciary is already subscribed to “The DNA Network!”

Reblog this post [with Zemanta]

Read Full Post »

An image of a 1901 examination in the faculty ...
Image via Wikipedia

I much enjoyed Helen Mayberg’s October 13th podcast, “Paths to Recovery in Major Depression: Insights from Functional Neuroimaging” hosted by Science & the City, the webzine of the NY Academy of Science. One comment that stuck with me was her mention of ‘brain-based algorithms’ for the diagnosis and treatment of mental illness. Indeed, from her talk, there are many brain regions involved in the regulation of mood and that individuals who experience depression may show poor activity in any or all of these brain regions. Also, Dr. Mayberg shows that these various brain regions may be more or less responsive to drug- vs. talk-based therapies. This seems like a major step forward in personalized medicine in psychiatry and perhaps might be augmented by other biomarkers. Presently, scanning is somewhat cumbersome relative to current drug-trial-and-error regimens, but the benefits of recovery far, far outweigh the costs of a lifetime of chronic illness.

Reblog this post [with Zemanta]

Read Full Post »

Follow

Get every new post delivered to your Inbox.

Join 29 other followers