Feeds:
Posts
Comments

Posts Tagged ‘Development’

groom

Learning to read emotions and faces is important for our well-being.  For some of us, the act of gazing into another person’s eyes is innately rewarding … especially if they are smiling.  New mothers and their infants can be found locked in each others smiling countenance … thus strengthening the developing neural pathways upon which the infant’s future social skills will grow.

One component of these neural pathways is the CNR1 gene expressed in the striatum and other brain regions that process rewarding and positively-reinforcing stimuli.  For most of us, a happy smiling face is positively rewarding … moreso with certain CNR1 genotypes.

From Drs. Baron-Cohen and Chakrabarti:

“A comparison of these results with those from our earlier fMRI study reveals that for the SNP rs806377, the allelic group (CC) associated with the highest striatal response is also associated with the longest gaze duration for happy faces. For rs806380, the allelic group associated with the highest striatal response (GG) is also associated with the longest gaze duration for happy faces.”

My 23andMe profile shows both the long-gaze CC and GG genotypes for rs806377 and rs806380.  Mmmmkay … I guess this would be a good time to apologize to all the girls I inappropriately stared at in the cafeteria back in college … even though you weren’t usually smiling back at me.  I guess my CNR1 and striatum were pretty overactive.

Read Full Post »

Are you good at reading faces?  You can test yourself  (here, here, here) or just get off the interwebz and go talk to a real person.

The MET and the AKT genes encode proteins that are involved in early brain development and in the production of new synapses.  Since reading faces requires a lifetime of trial-and-error learning (ie. making new synaptic connections), these genes would likely support the development of facial recognition skills.

From the original article:  “When the individuals who were [MET/AKT rs2237717/rs1130233] C carrier and G carrier simultaneously were used as the reference group, their facial emotion perception was better than that of those with TT/AA  (p=0.015).”

I’m a MET/AKT rs2237717/rs1130233 CC/GG and, as my genome predicts,  a pretty good face reader … but am not sure if this is a good thing.  Why are you looking at me like that?

Read Full Post »

Have you ever suddenly realized, “OMG, I’m just like my dad (or mom)!”  Oh, the horror .. the horror.  Here’s John Updike from A Month of Sundays:

Also my father, who in space-time occupied a stark room of a rest home an hour distant, which he furnished with a vigorous and Protean suite of senility’s phantoms, was in a genetic dimension unfolding within me, as time advanced, and occupying my body like, as Colette had written to illustrate another phenomenon, a hand being forced into a tight glove.

Read Full Post »

Construction work at the TVA's Douglas Dam, Te...

Image by The Library of Congress via Flickr

Nope …

“On mathematical grounds, it is difficult to understand how 10-to-the-14th synaptic connections in the human brain could be controlled by a genome with approximately 10-to-the-6th genes.”

“… the classic dichotomy between “hard-wired” nativism and the “plasticity” championed by anti-nativists was woefully off the mark. Historically, “Anti-nativists”—critics of the view that we might be born with significant mental structure prior to experience—have often attempted to downplay the significance of genes by appealing to neural plasticity, viz. the brain’s resilience to damage and its ability to modify itself in response to experience, while nativists often seem to think that their position rests on downplaying (or demonstrating limits on) plasticity.”

Well, sort of … think of genes as used for pre-wiring while experience then shapes the pre-wired system.

“… it may be more profitable to draw a distinction, between prewiring and rewiring—each of which can be had in abundance without precluding the other.”

Enhanced by Zemanta

Read Full Post »

Can you imagine uttering that phrase in the future? Yep.

“… transgenic mice with increased Setdb1 expression in adult forebrain neurons show antidepressant-like phenotypes in behavioral paradigms for anhedonia, despair and learned helplessness.”

SETDB1 is a protein that helps methylate lysine #9 on the histone H3 DNA binding protein … which leads to DNA CpG methylation … which leads to repression of the NMDA receptor subunit, NR2B/Grin2b … which leads to the anti-depressant-like phenotype.

Recall that 60% of CpGs are methylated and that, in the brain (unlike other terminally differentiated tissues), these methyl groups are popping on and off a lot … perhaps reflecting an ongoing, constant tuning of the inhibition/excitation balance.

thanks for the pic whaddap.

Enhanced by Zemanta

Read Full Post »

Myelin Repair Foundation Logo
Image by Myelin Repair Foundation via Flickr

from Ye et al., 2009:

HDAC1/2 genes encode proteins that modify the epigenome (make it less accessible for gene expression).

When HDAC1/2 functions around the HES5 and ID2/4 (repressors of white matter development) genes, the epigenetic changes (less acetylation of chromatin) helps to repress the repressors.

This type of epigenetic repression of gene expression (genes that repress white matter development) is essential for white matter development.

Enhanced by Zemanta

Read Full Post »

Yogic wisdom from kids?  Maybe.  Check out the upcoming lecture series at the Rubin Museum of Art: “Talk about Nothing” (literally, discussions on what “nothing” means) given by, among many others, developmental psychologist Alison Gopnik and scottish actor Brian Cox.

Alison Gopnik argues that the minds of children could help us understand deep philosophical questions. A father of a new family of two, acclaimed British Shakespearean Brian Cox explains how he divests himself of his own personality (no-self) before assuming another for the stage.

Professor Gopnik has some great books and online interviews (here, here, here) on this topic already!

From her new book, The Philosophical Baby:

This new science holds answers to some of the deepest and oldest questions about what it means to be human. A new baby’s captivated gaze at her mother’s face lays the foundations for love and morality. A toddler’s unstoppable explorations of his playpen hold the key to scientific discovery. A three-year-old’s wild make-believe explains how we can imagine the future, write novels, and invent new technologies. Alison Gopnik—a leading psychologist and philosopher, as well as a mother—explains the groundbreaking new psychological, neuroscientific, and philosophical developments in our understanding of very young children, transforming our understanding of how babies see the world, and in turn promoting a deeper appreciation for the role of parents.

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Cinematicode wall
Image by Smeerch via Flickr

As far as science movies go, the new movie, “To Age or Not To Age” seems like a lot of fun.  The interview with Dr. Leonard Guarente suggests that the sirtuin genes play a starring role in the film.  Certainly,  an NAD+ dependent histone deacetylase – makes for a sexy movie star – especially when it is able to sense diet and metabolism and establish the overall lifespan of an organism.

One comment in the movie trailer, by Aubrey de Grey, suggests that humans may someday be able to push the physiology of aging to extreme ends.  That studies of transgenic mice over-expressing SIRT1 showed physiological properties of calorie-restricted (long lived) mice – even when fed ad libitum – suggests that something similar might be possible in humans.

Pop a pill and live it up at your local Denny’s for the next 100 years?  Sounds nice (& a lot like grad school).

Just a few twists to the plot here.  It turns out that – in the brain – SIRT1 may not function as it does in the body.  Here’s a quote from a research article “Neuronal SIRT1 regulates endocrine and behavioral responses to calorie restriction” that inactivated SIRT1 just in the brain:

Our findings suggest that CR triggers a reduction in Sirt1 activity in hypothalamic neurons governing somatotropic signaling to lower this axis, in contrast with the activation of Sirt1 by CR in many other tissues. Sirt1 may have evolved to positively regulate the somatotropic axis, as it does insulin production in β cells, to control mammalian health span and life span in an overarching way. However, the fact that Sirt1 is a positive regulator of the somatotropic axis may complicate attempts to increase murine life span by whole-body activation of this sirtuin.

To a limited extent, it seems that – in the brain – SIRT1 has the normal function of promoting aging.  Therefore, developing “pills” that are activators of SIRT1 would be good for the body, but somehow might be counteracted by what the brain would do.  Who’s in charge anyway?  Mother Nature will not make it easy to cheat her! Another paper published recently also examined the role of SIRT1 in the brain and found that – normally – SIRT1 enhances neuronal plasticity (by blocking the expression of a  micro-RNA miR-134 that binds to the mRNA of, and inhibits the translation of, synaptic plasticity proteins such as CREB).

So, I won’t be first to line up for SIRT1 “activator” pills (such as Resveratrol), but I might pop a few if I’m trying to learn something new.

Enhanced by Zemanta

Read Full Post »

03.23.09 [#082] Yogurt Reach
Image by Jeezny via Flickr

Pity the poor brain.  What a job it has!  Did you know that just to reach into a refrigerator and grab a glass of milk, involves at least 50 or so key muscles in the hand, arm and shoulder which can, in principle, lead to over 1,000,000,000,000,000 possible combinations of muscle contractions?  Just so you know, this is 1,000 times MORE contraction possibilities than there are neurons in the brain (only a mere 1,000,000,000,000 neurons).  I’m sorry brain, I’ll keep my hands out of the fridge, I promise!

To accomplish this computational feat, Rodolfo R. Llinas and Sisir Roy in their paper entitled, “The ‘prediction imperative’ as the basis for self-awareness” [doi:10.1098/rstb.2008.0309] suggest that brain has evolved a number of strategies.

For starters, the authors point out that the brain can lower the computational workload of controlling motor output by sending motor control signals in a non-continuous and pulsatile fashion.

“We see that the underlying nature of movement is not smooth and continuous as our voluntary movements overtly appear; rather, the execution of movement is a discontinuous series of muscle twitches, the periodicity of which is highly regular.”

This computational strategy has the added benefit of making it easier to bind and synchronize motor-movement signals with a constant flow of sensory input:

“a periodic control system may allow for input and output to be bound in time; in other words, this type of control system might enhance the ability of sensory inputs and descending motor command/controls to be integrated within the functioning motor apparatus as a whole.“

Another strategy is the use of memory for the purposes of prediction (actually, their paper is part of a special theme issue from the Philosophical Transactions of the Royal Society B entitled, Predictions in the brain: using our past to prepare for the future).  The authors describe the way in which neural circuits in the body and brain are inherently good at learning and storing information which makes them very good at using that information for making predictions and pre-prepared plans for what to do with expected incoming sensory inputs.  These neural mechanisms may also help reduce computational loads associated with moving and coordinating the body.  Interestingly, the authors note,

“while prediction is localized in the CNS, it is a distributed function and does not have a single location within the brain. What is the repository of predictive function? The answer lies in what we call the self, i.e. the self is the centralization of the predictive imperative.  The self is not born out of the realm of consciousness—only the noticing of it is (i.e. self-awareness).”  Here’s a link to Llinas’ book on where the “self” resides.

Lastly, the authors suggest that the genome might encode certain structural and functional aspects of neural development that create a bias for certain types of computation and prime neural networks with a Bayesian type of prior knowledge.  Their idea is akin to an organism being “experience expectant” rather than a pure blank slate that has to learn every stimulus-response contingency by trial-and-error.  To support their notion of the role of the genome, the authors cite a 2003 study from the Yonas Lab on the development of depth perception.  Another related study is covered here.

Methinks that genetic variants might someday be understood in terms of how they bias computational processes.  Something to shoot for in the decades to come!

Enhanced by Zemanta

Read Full Post »

Where's Waldo in Google Maps?
Image by Si1very via Flickr

In an earlier post on Williams Syndrome, we delved into the notion that sometimes a genetic variant can lead to enhanced function – such as certain social behaviors in the case of WS.  A mechanism that is thought to underlie this phenomenon has to do with the way in which information processing in the brain is widely distributed and that sometimes a gene variant can impact one processing pathway, while leaving another pathway intact, or even upregulated.  In the case of Williams Syndrome a relatively intact ventral stream (“what”) processing but disrupted dorsal stream (“where”) processing leads to weaker projections to the frontal cortex and amygdala which may facilitate gregarious and prosocial (a lack of fear and inhibition) behavior.  Other developmental disabilities may differentially disrupt these 2 visual information processing pathways.  For instance, developmental dyspraxia contrasts with WS as it differentially disrupts the ventral stream processing pathway.

A recent paper by Woodcock and colleagues in their article, “Dorsal and ventral stream mediated visual processing in genetic subtypes of Prader–Willi syndrome” [doi:10.1016/j.neuropsychologia.2008.09.019] ask how another developmental disability – Prader-Willi syndrome – might differentially influence the development of these information processing pathways.  PWS arises from the lack of expression (via deletion or uniparental disomy) of a cluster of paternally expressed genes in the 15q11-13 region (normally the gene on the maternally inherited chromosome is silent, or imprintedrelated post here).  By comparing PWS children to matched controls, the team reports evidence showing that PWS children who carry the deletion are slightly more impaired in a task that depends on the dorsal “where” pathway whilst some sparing or relative strength in the ventral “what” pathway.

Reblog this post [with Zemanta]

Read Full Post »

Corticotropin-releasing hormone
Image via Wikipedia

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension“  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar

Reblog this post [with Zemanta]

Read Full Post »

An historic find has occurred in the quest (gold-rush, if you will) to link genome variation with brain structure-function variation.  This is the publication of the very first genome-wide (GWAS) analysis of individual voxels (voxels are akin to pixels in a photograph, but are rather 3D cubes of brain-image-space about 1mm on each side) of brain structure – Voxelwise genome-wide association study (vGWAS) [doi: 10.1016/j.neuroimage.2010.02.032] by Jason Stein and colleagues under the leadership of Paul M. Thompson, a  leader in the area of neuroimaging and genetics – well-known for his work on brain structure in twin and psychiatric patient populations.

In an effort to discover genes that contribute to individual differences in brain structure, the authors took on the task of statistically analyzing the some 31,622 voxels (per brain) obtained from high-resolution structural brain scans; with 448,293 Illumina SNP genotypes (per person) with minor allele frequencies greater than 0.1 (common variants); in 740 unrelated healthy caucasian adults.  When performed on a voxel-by-voxel basis, this amounts to some 14 billion statistical tests.

Yikes!  A statistical nightmare with plenty of room for false positive results, not to mention the recent disillusionment with the common-variant GWAS approach?  Certainly.  The authors describe these pitfalls and other scenarios wherein false data is likely to arise and most of the paper addresses the pros and cons of different statistical analysis strategies – some which are prohibitive in their computational demands.  Undaunted, the authors describe several approaches for establishing appropriate thresholds and then utilize a ‘winner take all’ analysis strategy wherein a single ‘most-associated winning snp’ is identified for each voxel, which when clustered together in hot spots (at P = 2 x 10e-10), can point to specific brain areas of interest.

Using this analytical approach, the authors report that 8,212 snps were identified as ‘winning, most-associated’ snps across the 31,622 voxels.  They note that there was not as much symmetry with respect to winning snps in the left hemispere and corresponding areas in the right hemisphere, as one might have expected.  The 2 most significant snps across the entire brain and genome were rs2132683 and rs713155 which were associated with white matter near the left posterior lateral ventricle.  Other notable findings were rs2429582 in the synaptic (and possible autism risk factor) CADPS2 gene which was associated with temporal lobe structure and rs9990343 which sits in an intergenic region but is associated with frontal lobe structure.  These and several other notable snps are reported and brain maps are provided that show where in the brain each snp is associated.

As in most genome-wide studies, one can imagine that the authors were initially bewildered by their unexpected findings.  None of the ‘usual suspects’ such as neurotransmitter receptors, transcription factors, etc. etc. that dominate the psychiatric genetics literature.  Bewildered, perhaps, but maybe thats part of the fun and excitement of discovery!  Very exciting stuff to come I’ll bet as this new era unfolds!

Reblog this post [with Zemanta]

Read Full Post »

wotd044
Image by theloushe via Flickr

** PODCAST accompanies this post**

I have a little boy who loves to run and jump and scream and shout – a lot.  And by this, I mean running – at full speed and smashing his head into my gut,  jumping – off the couch onto my head,  screaming – spontaneous curses and R-rated body parts and bodily functions.  I hope you get the idea.  Is this normal? or (as I oft imagine) will I soon be sitting across the desk from a school psychologist pitching me the merits of an ADHD diagnosis and medication?

Of course, when it comes to behavior, there is not a distinct line one can cross from normal to abnormal.  Human behavior is complex, multi-dimensional and greatly interpreted through the lens of culture.  Our present culture is highly saturated by mass-marketing, making it easy to distort a person’s sense of “what’s normal” and create demand for consumer products that folks don’t really need (eg. psychiatric diagnoses? medications?).   Anyhow, its tough to know what’s normal.  This is an important issue to consider for those (mass-marketing hucksters?) who might be inclined to promote genetic data as “hard evidence” for illness, disorder or abnormality of some sort.

With this in mind, I really enjoyed a recent paper by Stollstorff et al., “Neural response to working memory load varies by dopamine transporter genotype in children” [doi:10.1016/j.neuroimage.2009.12.104] who asked how the brains of healthy children functioned, even though they carry a genotype that has been widely associated with the risk of ADHD.  Healthy children who carry genetic risk for ADHD. Hmm, might this be my boy?

The researchers looked at a 9- vs. 10-repeat VNTR polymorphism in the 3′-UTR of the dopamine transporter gene (DAT1).  This gene – which encodes the very protein that is targeted by so many ADHD medications – influences the re-uptake of dopamine from the synaptic cleft.  In the case of 10/10 genotypes, it seems that DAT1 is more highly expressed, thus leading to more re-uptake and hence less dopamine in the synaptic cleft.  Generally, dopamine is needed to enhance the signal/noise of neurotransmission, so – at the end of the day – the 10/10 genotype is considered less optimal than the 9/9-repeat genotype.  As noted by the researchers, the ADHD literature shows that the 10-repeat allele, not the 9-repeat, is most often associated with ADHD.

The research team asked these healthy children (typically developing children between 7 and 12 years of age) to perform a so-called N-back task which requires that children remember words that are presented to them one-at-a-time.  Each time a new word is presented, the children had to decide whether that word was the same as the previous word (1-back) or the previous, previous word (2-back).  Its a maddening task and places an extreme demand on neural circuits involved in active maintenance of information (frontal cortex) as well as inhibition of irrelevant information that occurs during updating (basal ganglia circuits).

As the DAT1 protein is widely expressed in the basal ganglia, the research team asked where in the brain was variation in the DAT1 (9- vs. 10-repeat) associated with neural activity?  and where was there a further difference between 1-back and 2-back?  Indeed, the team finds that brain activity in many regions of the basal ganglia (caudate, putamen, substantia nigra & subthalamic nucleus) were associated with genetic variation in DAT1.  Neat!  the gene may be exerting an influence on brain function (and behavior) in healthy children, even though they do not carry a diagnosis.  Certainly, genes are not destiny, even though they do influence brain and behavior.

What was cooler to me though, is the way the investigators examined the role of genetic variation in the 1-back (easy or low load condition) vs. 2-back (harder, high-load condition) tasks.  Their data shows that there was less of an effect of genotype on brain activation in the easy tasks.  Rather, only when the task was hard, did it become clear that the basal ganglia in the 10/10 carriers was lacking the necessary brain activation needed to perform the more difficult task.  Thus, the investigators reveal that the genetic risk may not be immediately apparent under conditions where heavy “loads” or demands are not placed on the brain.  Cognitive load matters when interpreting genetic data!

This result made me think that genes in the brain might be a lot like genes in muscles.  Individual differences in muscle strength are not associated with genotype when kids are lifting feathers.  Only when kids are actually training and using their muscles, might one start to see that some genetically advantaged kids have muscles that strengthen faster than others.  Does this mean there is a “weak muscle gene” – yes, perhaps.  But with the proper training regimen, children carrying such a “weak muscle gene” would be able to gain plenty of strength.

I guess its off to the mental and physical gyms for me and my son.

** PODCAST accompanies this post** also, here’s a link to the Vaidya lab!

Reblog this post [with Zemanta]

Read Full Post »

Recreated :File:Neuron-no labels2.png in Inksc...
Image via Wikipedia

The A-to-T SNP rs7794745 in the CNTNAP2 gene was found to be associated with increased risk of autism (see Arking et al., 2008).  Specifically, the TT genotype, found in about 15% of individuals, increases these folks’ risk by about 1.2-1.7-fold.  Sure enough, when I checked my 23andMe profile, I found that I’m one of these TT risk-bearing individuals.  Interesting, although not alarming since me and my kids are beyond the age where one typically worries about autism.  Still, one can wonder if such a risk factor might have exerted some influence on the development of my brain?

The recent paper by Tan et al., “Normal variation in fronto-occipital circuitry and cerebellar structure with an autism-associated polymorphism of CNTNAP2” [doi:10.1016/j.neuroimage.2010.02.018 ] suggests there may be subtle, but still profound influences of the TT genotype on brain development in healthy individuals.  According to the authors, “homozygotes for the risk allele showed significant reductions in grey and white matter volume and fractional anisotropy in several regions that have already been implicated in ASD, including the cerebellum, fusiform gyrus, occipital and frontal cortices. Male homozygotes for the risk alleles showed greater reductions in grey matter in the right frontal pole and in FA in the right rostral fronto-occipital fasciculus compared to their female counterparts who showed greater reductions in FA of the anterior thalamic radiation.”

The FA (fractional anisotropy – a measurement of white-matter or myelination) results are consistent with a role of CNTNAP2 in the establishment of synaptic contacts and other cell-cell contacts especially at Nodes of Ranvier – which are critical for proper function of white-matter tracts that support rapid, long-range neural transmission.  Indeed, more severe mutations in CNTNAP2  have been associated with cortical dysplasia and focal epilepsy (Strauss et al., 2006).

Subtle changes perhaps influencing long-range information flow in my brain – wow!

More on CNTNAP2 … its evolutionary history and role in language development.

Reblog this post [with Zemanta]

Read Full Post »

03230052.JPG
Image by mbrownstone via Flickr

Walter Dean Myers, an author of The Young Landlords and many other classic coming of age novels once remarked, “The special place of the young adult novel should be in its ability to address the needs of the reader to understand his or her relationships with the world, with each other, and with adults.“  Indeed, the wonderful elaborations of psychosocial development that occur during the teenage years makes for a vivid and tumultuous time – worthy of many a book – especially those like Myers’ that so help adolescents to cope.  During this time, a child’s brain and body is supplanted by adult systems, which, from a physiological point of view, place the adolescent’s mind and body at the mercy of thousands of shifting biochemical processes.  Such a notion of the shifting sands of adolescence were brought to mind while reading a research article focused on one – just one single example – of biochemical change.

The paper entitled, “Cortico-striatal synaptic defects and OCD-like behaviors in SAPAP3 mutant mice” [doi: 10.1038/nature06104] points out that mice who lack the function of the post-synaptic density scaffolding protein encoded by the SAPAP3 gene display excessive grooming and other behaviors reminiscent of obsessive compulsive disorder – a condition that frequently emerges during adolescence.  One of the main findings of the paper is that a normal developmental shift of NR2B –> NR2A subunits of the NMDA receptor does NOT seem to occur – rendering the SAPAP3 mutant mice with an immature form of NMDA receptor.  The authors suggest that this may be the underlying reason for the aberrant behavior, and were able to normalize the mutant mice by re-introducing SAPAP3 protein via a lentiviral-mediated expression vector placed in the striatum.

Gosh.  This NR2B –> NR2A shift is just one example – one grain – in the shifting biochemical sands of development.  Just one of thousands.  How did my brain ever make it through?

Reblog this post [with Zemanta]

Read Full Post »

Summer, Brody and Audric Hug
Image by cobalt123 via Flickr

If you have a minute, check out this “Autism Sensory Overload Simulation” video to get a feel for the perceptual difficulties experienced by people with autism spectrum disorders.  A recent article, “Critical Period Plasticity Is Disrupted in the Barrel Cortex of Fmr1 Knockout Mice” [doi: 10.1016/j.neuron.2010.01.024] provides some clues to the cellular mechanisms that are involved in this phenomenon.  The authors examined the developing somatosensory cortex in lab mice who carry a mutation in a gene called FMR1.  The normal function of this gene is to help synapses mature and optimize their strength through a process known as activity-dependent plasticity.  This a kind of “use-it-or-lose-it” neural activity that is important when you are practicing and practicing to learn something new – say, like riding a bike, or learning a new language.  Improvements in performance that come from “using” the circuits in the brain are correlated with optimized synaptic connections – via a complex set of biochemical reactions (eg. AMPA receptor trafficking).

When FMR1 is not functioning, neuronal connections (in this case, synapses that connect the thalamus to the somatosensory cortex) cannot mature and develop properly.  This wreaks havoc in the developing brain where maturation can occur in successive critical periods – where the maturation of one circuit is needed to ensure the subsequent development of another.  Hence, the authors suggest, the type of sensory overload reported in the autism spectrum disorders may be related to a similar type of developmental anomaly in the somatosensory cortex.

Reblog this post [with Zemanta]

Read Full Post »

Church Steeple
Image by muffintoptn via Flickr

Humans are spiritual creatures – there’s no denyin’.  How & why we got this way is one of THE BIG questions of all time.  Since our genome shapes the development of our brain and its interaction with our culture, its not a surprise to see that, from time to time, folks will look for and find genetic links to various forms of spiritual and religious behavior.  Here’s a recent paper from Kenneth Kendler’s research team at the Virginia Institute for Psychiatric and Behavioral Genetics, Virginia Commonwealth University School of Medicine entitled, “A Developmental Twin Study of Church Attendance and Alcohol and Nicotine Consumption: A Model for Analyzing the Changing Impact of Genes and Environment” [link to abstract].  An analysis of more than 700 pairs of twins found that the correlation between alcohol and nicotine consumption and church attendance (more church predicts less smokin’ and drinkin’) is more than 50% influenced by genetic factors – in adults.  In children and teens, the genetic contribution to the correlation is much less and the strength of the correlation stems more from shared environmental factors (parents, school etc.).  Is there a gene for going to church? Nope.  Are there genes that shape a person’s inclination toward novelty or conscientiousness? More likely so.  Are they distributed across all races and cultures? Yep.  Lots to ponder next Sunday morning.

Reblog this post [with Zemanta]

Read Full Post »

Novelty candles may be used.
Image via Wikipedia

Everyone has a birthday right. Its the day you (your infant self) popped into the world and started breathing, right?  But what about the day “you” were born – that is – “you” in the more philosophical, Jungian, spiritual, social, etc. kind of a way when you became aware of being in some ways apart from others and the world around you.  In her 1997 paper, “The Basal Ganglia and Cognitive Pattern Generators“, Professor Ann Graybiel writes,

The link between intent and action may also have a quite specific function during development. This set of circuits may provide part of the neural mechanism for building up cognitive patterns involving recognition of the self. It is well documented that, as voluntary motor behaviors develop and as feedback about the consequences of these behaviors occurs, the perceptuomotor world of the infant develops (Gibson 1969). These same correlations among intent, action, and consequence also offer a simple way for the young organism to acquire the distinction between actively initiated and passively received events. As a result, the infant can acquire the recognition of self as actor. The iterative nature of many basal ganglia connections and the apparent involvement of the basal ganglia in some forms of learning could provide a mechanism for this development of self-awareness.

As Professor Graybiel relates the “self” to function in the basal-ganglia and the so-called cortico-thalamic basal-ganglia loops – a set of parallel circuits that help to properly filter internal mental activity into specific actions and executable decisions – I got a kick out of a paper that describes how the development of the basal-ganglia can go awry for cells that are born at certain times.

Check out the paper, “Modular patterning of structure and function of the striatum by retinoid receptor signaling” by Liao et al.   It reveals that mice who lack a certain retinoic acid receptor gene (RARbeta) have a type of defective neurogenesis in late-born cells that make up a part of the basal ganglia (striatum) known as a striosome.  Normally, the authors say, retinoic acid helps to expand a population of late-born striosomal cells, but in the RARbeta mutant mice, the rostral striosomes remain under-developed.   When given dopaminergic stimulation, these mutant mice showed slightly less grooming and more sterotypic behaviors.

So when was “my self’s” birthday?  Was it when these late-born striosomal cells were, umm, born?  Who knows, but I’m glad my retinoic acid system was intact.

Reblog this post [with Zemanta]

Read Full Post »

Diagram to illustrate Minute Structure of the ...
Image via Wikipedia

For a great many reasons, research on mental illness is focused on the frontal cortex.  Its just a small part of the brain, and certainly, many things can go wrong in other places during brain/cognitive development, but, it remains a robust finding, that when the frontal cortex is not working well, individuals have difficulties in regulating thoughts and emotions.  Life is difficult enough to manage, let alone without a well functioning frontal cortex.  So its no surprise that many laboratories look very closely at how this region develops prenatally and during childhood.

One of the more powerful genetic methods is the analysis of gene expression via microarrays (here is a link to a tutorial on this technology).  When this technology is coupled with extremely careful histological analysis and dissection of cortical circuits in the frontal cortex, it begins to become possible to begin to link changes in gene expression with the physiological properties of specific cells and local circuits in the frontal cortex. The reason this is an exciting pursuit is because the mammalian neocortex is organized in a type of layered fashion wherein 6 major layers have different types of connectivity and functionality.  The developmental origins of this functional specificity are thought to lie in a process known as radial migration (here is a video of a neuron as it migrates radially and finds its place in the cortical hierarchy).  As cells are queued out of the ventricular zone, and begin their migration to the cortical surface, they are exposed to all sorts of growth factors and morphogens that help them differentiate and form the proper connectivities.  Thus, the genes that regulate this process are of keen interest to understanding normal and abnormal cognitive development.

Here’s an amazing example of this – 2 papers entitled, “Infragranular gene expression disturbances in the prefrontal cortex in schizophrenia: Signature of altered neural development?” [doi:10.1016/j.nbd.2009.12.013] and “Molecular markers distinguishing supragranular and infragranular layers in the human prefrontal cortex [doi:10.1111/j.1460-9568.2007.05396.x] both by Dominique Arion and colleagues.  In both papers, the authors ask, “what genes are differentially expressed in different layers of the cortex?”.  This is a powerful line of inquiry since the different layers of cortex are functionally different in terms of their connectivity.  For example, layers II-III (the so-called supragranular layers) are known to connect mainly to other cortical neurons – which is different functionally than layers V-VI (the so-called infragranular layers) that connect mainly to the striatum (layer V) and thalamus (layer VI).  Thus, if there are genes whose expression is unique to a layer, then one has a clue as to how that gene might contribute to normal/abnormal information processing.

The authors hail from a laboratory that is well-known for work over many years on fine-scaled histological analysis of the frontal cortex at the University of Pittsburgh and used a method called, laser capture microdissection, where post-mortem sections of human frontal cortex (area 46) were cut to separate the infragraular layer from the supragranular layer.  The mRNA from these tissue sections was then used for DNA microarray hybridization.  Various controls, replicate startegies and in-situ tissue hybridizations were then employed to validate the initial microarray results.

In first paper, the where the authors compare infra vs. supragranular layers, they report that 40 genes were more highly expressed in the supragranular layers (HOP, CUTL2 and MPPE1 were among the most enriched) and 29 genes were highly expressed in the infragranular layers (ZNF312, CHN2, HS3ST2 were among the most enriched).  Other differentially expressed genes included several that have previously been implicated in cortical layer formation such as RLN, TLX-NR2E1, SEMA3E, PCP4, SERPINE2, NR2F2/ARP1, PCDH8, WIF1, JAG1, MBP.  Amazing!! A handful of genes that seem to label subpopulations of projection neurons in the frontal cortex.  Polymorphic markers for these genes would surely be powerful tools for imaging-genetic studies on cognitive development.

In the second paper, the authors compare infra vs. supragranular gene expression in post-mortem brains from patients with schizophrenia and healthy matched controls. Using the same methods, the team reports both supra- and infragranular gene expression changes in schizophrenia (400 & 1200 differences respectively) – more than 70% of the differences appearing to be reductions in gene expression in schizophrenia. Interestingly, the team reports that the genes that were differentially expressed in the infragranular layers provided sufficient information to discriminate between cases and controls, whilst the gene expression differences in the supragranular layers did not.  More to the point, the team finds that 51 genes that were differentially expressed in infra- vs. supragranular expression were also differentially expressed in cases vs. controls  (many of these are also found to be associated in population genetic association studies of schiz vs. control as well!).  Thus, the team has identified layer (function) -specific genes that are associated with schizophrenia.  These genes, the ones enriched in the infragranular layers especially, seem to be at the crux of a poorly functioning frontal cortex.

The authors point to 3 such genes (SEMA3E, SEMA6D, SEMA3C) who happen to members of the same gene family – the semaphorin gene family.  This gene family is very important for the neuronal guidance (during radial migration), morphology, pruning and other processes where cell shape and position are regulated.  The authors propose that the semaphorins might act as “integrators” of various forms of wiring during development and in adulthood.  More broadly, the authors provide a framework to understand how the development of connectivity on the frontal cortex is regulated by genetic factors – indeed, many suspected genetic risk factors play a role in the developmental pathways the authors have focused on.

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »

Follow

Get every new post delivered to your Inbox.

Join 30 other followers