Also my father, who in space-time occupied a stark room of a rest home an hour distant, which he furnished with a vigorous and Protean suite of senility’s phantoms, was in a genetic dimension unfolding within me, as time advanced, and occupying my body like, as Colette had written to illustrate another phenomenon, a hand being forced into a tight glove.

Image by The Library of Congress via Flickr

Nope …

“On mathematical grounds, it is difficult to understand how 10-to-the-14th synaptic connections in the human brain could be controlled by a genome with approximately 10-to-the-6th genes.”

“… the classic dichotomy between “hard-wired” nativism and the “plasticity” championed by anti-nativists was woefully off the mark. Historically, “Anti-nativists”—critics of the view that we might be born with significant mental structure prior to experience—have often attempted to downplay the significance of genes by appealing to neural plasticity, viz. the brain’s resilience to damage and its ability to modify itself in response to experience, while nativists often seem to think that their position rests on downplaying (or demonstrating limits on) plasticity.”

Well, sort of … think of genes as used for pre-wiring while experience then shapes the pre-wired system.

“… it may be more profitable to draw a distinction, between prewiring and rewiring—each of which can be had in abundance without precluding the other.”

“… transgenic mice with increased Setdb1 expression in adult forebrain neurons show antidepressant-like phenotypes in behavioral paradigms for anhedonia, despair and learned helplessness.”

SETDB1 is a protein that helps methylate lysine #9 on the histone H3 DNA binding protein … which leads to DNA CpG methylation … which leads to repression of the NMDA receptor subunit, NR2B/Grin2b … which leads to the anti-depressant-like phenotype.

Recall that 60% of CpGs are methylated and that, in the brain (unlike other terminally differentiated tissues), these methyl groups are popping on and off a lot … perhaps reflecting an ongoing, constant tuning of the inhibition/excitation balance.

thanks for the pic whaddap.

from Ye et al., 2009:

HDAC1/2 genes encode proteins that modify the epigenome (make it less accessible for gene expression).

When HDAC1/2 functions around the HES5 and ID2/4 (repressors of white matter development) genes, the epigenetic changes (less acetylation of chromatin) helps to repress the repressors.

This type of epigenetic repression of gene expression (genes that repress white matter development) is essential for white matter development.

Alison Gopnik argues that the minds of children could help us understand deep philosophical questions. A father of a new family of two, acclaimed British Shakespearean Brian Cox explains how he divests himself of his own personality (no-self) before assuming another for the stage.

Professor Gopnik has some great books and online interviews (here, here, here) on this topic already!

From her new book, The Philosophical Baby:

This new science holds answers to some of the deepest and oldest questions about what it means to be human. A new baby’s captivated gaze at her mother’s face lays the foundations for love and morality. A toddler’s unstoppable explorations of his playpen hold the key to scientific discovery. A three-year-old’s wild make-believe explains how we can imagine the future, write novels, and invent new technologies. Alison Gopnik—a leading psychologist and philosopher, as well as a mother—explains the groundbreaking new psychological, neuroscientific, and philosophical developments in our understanding of very young children, transforming our understanding of how babies see the world, and in turn promoting a deeper appreciation for the role of parents.

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

As far as science movies go, the new movie, “To Age or Not To Age” seems like a lot of fun.  The interview with Dr. Leonard Guarente suggests that the sirtuin genes play a starring role in the film.  Certainly,  an NAD+ dependent histone deacetylase – makes for a sexy movie star – especially when it is able to sense diet and metabolism and establish the overall lifespan of an organism.

One comment in the movie trailer, by Aubrey de Grey, suggests that humans may someday be able to push the physiology of aging to extreme ends.  That studies of transgenic mice over-expressing SIRT1 showed physiological properties of calorie-restricted (long lived) mice – even when fed ad libitum – suggests that something similar might be possible in humans.

Pop a pill and live it up at your local Denny’s for the next 100 years?  Sounds nice (& a lot like grad school).

Just a few twists to the plot here.  It turns out that – in the brain – SIRT1 may not function as it does in the body.  Here’s a quote from a research article “Neuronal SIRT1 regulates endocrine and behavioral responses to calorie restriction” that inactivated SIRT1 just in the brain:

Our findings suggest that CR triggers a reduction in Sirt1 activity in hypothalamic neurons governing somatotropic signaling to lower this axis, in contrast with the activation of Sirt1 by CR in many other tissues. Sirt1 may have evolved to positively regulate the somatotropic axis, as it does insulin production in β cells, to control mammalian health span and life span in an overarching way. However, the fact that Sirt1 is a positive regulator of the somatotropic axis may complicate attempts to increase murine life span by whole-body activation of this sirtuin.

To a limited extent, it seems that – in the brain – SIRT1 has the normal function of promoting aging.  Therefore, developing “pills” that are activators of SIRT1 would be good for the body, but somehow might be counteracted by what the brain would do.  Who’s in charge anyway?  Mother Nature will not make it easy to cheat her! Another paper published recently also examined the role of SIRT1 in the brain and found that – normally – SIRT1 enhances neuronal plasticity (by blocking the expression of a  micro-RNA miR-134 that binds to the mRNA of, and inhibits the translation of, synaptic plasticity proteins such as CREB).

So, I won’t be first to line up for SIRT1 “activator” pills (such as Resveratrol), but I might pop a few if I’m trying to learn something new.

Pity the poor brain.  What a job it has!  Did you know that just to reach into a refrigerator and grab a glass of milk, involves at least 50 or so key muscles in the hand, arm and shoulder which can, in principle, lead to over 1,000,000,000,000,000 possible combinations of muscle contractions?  Just so you know, this is 1,000 times MORE contraction possibilities than there are neurons in the brain (only a mere 1,000,000,000,000 neurons).  I’m sorry brain, I’ll keep my hands out of the fridge, I promise!

To accomplish this computational feat, Rodolfo R. Llinas and Sisir Roy in their paper entitled, “The ‘prediction imperative’ as the basis for self-awareness” [doi:10.1098/rstb.2008.0309] suggest that brain has evolved a number of strategies.

For starters, the authors point out that the brain can lower the computational workload of controlling motor output by sending motor control signals in a non-continuous and pulsatile fashion.

“We see that the underlying nature of movement is not smooth and continuous as our voluntary movements overtly appear; rather, the execution of movement is a discontinuous series of muscle twitches, the periodicity of which is highly regular.”

This computational strategy has the added benefit of making it easier to bind and synchronize motor-movement signals with a constant flow of sensory input:

“a periodic control system may allow for input and output to be bound in time; in other words, this type of control system might enhance the ability of sensory inputs and descending motor command/controls to be integrated within the functioning motor apparatus as a whole.“

Another strategy is the use of memory for the purposes of prediction (actually, their paper is part of a special theme issue from the Philosophical Transactions of the Royal Society B entitled, Predictions in the brain: using our past to prepare for the future).  The authors describe the way in which neural circuits in the body and brain are inherently good at learning and storing information which makes them very good at using that information for making predictions and pre-prepared plans for what to do with expected incoming sensory inputs.  These neural mechanisms may also help reduce computational loads associated with moving and coordinating the body.  Interestingly, the authors note,

“while prediction is localized in the CNS, it is a distributed function and does not have a single location within the brain. What is the repository of predictive function? The answer lies in what we call the self, i.e. the self is the centralization of the predictive imperative.  The self is not born out of the realm of consciousness—only the noticing of it is (i.e. self-awareness).”  Here’s a link to Llinas’ book on where the “self” resides.

Lastly, the authors suggest that the genome might encode certain structural and functional aspects of neural development that create a bias for certain types of computation and prime neural networks with a Bayesian type of prior knowledge.  Their idea is akin to an organism being “experience expectant” rather than a pure blank slate that has to learn every stimulus-response contingency by trial-and-error.  To support their notion of the role of the genome, the authors cite a 2003 study from the Yonas Lab on the development of depth perception.  Another related study is covered here.

Methinks that genetic variants might someday be understood in terms of how they bias computational processes.  Something to shoot for in the decades to come!

In an earlier post on Williams Syndrome, we delved into the notion that sometimes a genetic variant can lead to enhanced function – such as certain social behaviors in the case of WS.  A mechanism that is thought to underlie this phenomenon has to do with the way in which information processing in the brain is widely distributed and that sometimes a gene variant can impact one processing pathway, while leaving another pathway intact, or even upregulated.  In the case of Williams Syndrome a relatively intact ventral stream (“what”) processing but disrupted dorsal stream (“where”) processing leads to weaker projections to the frontal cortex and amygdala which may facilitate gregarious and prosocial (a lack of fear and inhibition) behavior.  Other developmental disabilities may differentially disrupt these 2 visual information processing pathways.  For instance, developmental dyspraxia contrasts with WS as it differentially disrupts the ventral stream processing pathway.

A recent paper by Woodcock and colleagues in their article, “Dorsal and ventral stream mediated visual processing in genetic subtypes of Prader–Willi syndrome” [doi:10.1016/j.neuropsychologia.2008.09.019] ask how another developmental disability – Prader-Willi syndrome – might differentially influence the development of these information processing pathways.  PWS arises from the lack of expression (via deletion or uniparental disomy) of a cluster of paternally expressed genes in the 15q11-13 region (normally the gene on the maternally inherited chromosome is silent, or imprinted – related post here).  By comparing PWS children to matched controls, the team reports evidence showing that PWS children who carry the deletion are slightly more impaired in a task that depends on the dorsal “where” pathway whilst some sparing or relative strength in the ventral “what” pathway.

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension“  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar