I dunno Yang.  Lets focus on variation.  Genome sequence variation can vary with the brain  … and … gene expression can vary with the brain  … however … genome sequence variation can vary with gene expression … but … here’s a paper showing that gene expression is under the control of genome sequence variation. Purrrr.

Hey Yin, the correlation between genome sequence variation and gene expression confuses me.  I mean, gene expression can change if the environment changes right?  Doesn’t this confound research that uses genome sequence variation?

Meow.

thanks for the pic noyfb.

from Ye et al., 2009:

HDAC1/2 genes encode proteins that modify the epigenome (make it less accessible for gene expression).

When HDAC1/2 functions around the HES5 and ID2/4 (repressors of white matter development) genes, the epigenetic changes (less acetylation of chromatin) helps to repress the repressors.

This type of epigenetic repression of gene expression (genes that repress white matter development) is essential for white matter development.

You already know this, but when you are stressed out (chronic stress), your brain doesn’t work very well.  That’s right – just when you need it most – your brain has a way of letting you down!

Here are a few things that happen to the very cells (in the hippocampus) that you rely on:

- reorganization within mossy fiber terminals
- loss of excitatory glutamatergic synapses
- reduction in the surface area of postsynaptic densities
- marked retraction of thorny excrescences
- alterations in the lengths of the terminal dendritic segments of pyramidal cells
- reduction of the dorsal anterior CA1 area volume

Thanks brain!  Thanks neurons for abandoning me when I need you most!  According to this article, these cellular changes lead to, “impaired hippocampal involvement in episodic, declarative, contextual and spatial memory – likely to debilitate an individual’s ability to process information in new situations and to make decisions about how to deal with new challenges.” UGH!

Are our cells making these changes for a reason?  Might it be better for cells to remodel temporarily rather than suffer permanent, life-long damage?  Perhaps.  Perhaps there are molecular pathways that can lead the reversal of these allostatic stress adaptations?

Check out this recent paper: “A negative regulator of MAP kinase causes depressive behavior” [doi 10.1038/nm.2219]  the authors have identified a gene – MKP-1 – a phosphatase that normally dephosphorylates various MAP kinases involved in cellular growth, that, when inactivated in mice, produces animals that are resistant to chronic unpredictable stress.  Although its known that MKP-1 is needed to limit immune responses associated with multi-organ failure during bacterial infections, the authors suggest:

“pharmacological blockade of MKP-1 would produce a resilient of anti-depressant response to stress”

Hmmm … so Mother Nature is using the same gene to regulate the immune response (turn it off so that it doesn’t damage the rest of the body) and to regulate synaptic growth (turn it off – which is something we DON’T want to do when we’re trying to recover from chronic stress)?  Mother Nature gives us MKP-1 so I can survive an infection, but the same gene prevents us from recovering (finding happiness) from stress?

Of course, we do not need to rely only on pharmacological solutions.  Exercise & social integration are cited by these authors as the top 2 non-medication strategies.

Most cells in your adult body are “terminally differentiated” – meaning that they have developed from stem cells into the final liver, or heart, or muscle or endothelial cell that they were meant to be.  From that point onward, cells are able to “remember” to stay in this final state – in part – via stable patterns of DNA methylation that reinforce the regulation of “the end state” of gene expression for that cell.  As evidence for this role of DNA methylation, it has been observed that levels of DNA methyl transferase (DNMT) decline when cells are fully differentiated and thus, cannot modify or disrupt their patterns of methylation.

NOT the case in the brain! Even though neurons in the adult brain are fully differentiated, levels of methyl transferases – DO NOT decline.  Why not? Afterall, we wouldn’t want our neurons to turn into liver cells, or big toe cells, would we?

One hypothesis, suggested by David Sweatt and colleagues is that neurons have more important things to “remember”.   They suggest in their fee and open research article, “Evidence That DNA (Cytosine-5) Methyltransferase Regulates Synaptic Plasticity in the Hippocampus” [doi: 10.1074/jbc.M511767200] that:

DNA methylation could have lasting effects on neuronal gene expression and overall functional state. We hypothesize that direct modification of DNA, in the form of DNA (cytosine-5) methylation, is another epigenetic mechanism for long term information storage in the nervous system.

By measuring methylated vs. unmethylated DNA in the promoter of the reelin and BDNF genes and relating this to electrophysiological measures of synaptic plasticity, the research team finds correlations between methylation status and synaptic plasticity.  More specifically, they find that zebularine (an inhibitor of DNMT) CAN block long-term potentiation (LTP), but NOT block baseline synaptic transmission nor the ability of synapses to fire in a theta-burst pattern (needed to induce LTP).

This suggests that the epigenetic machinery used for DNA methylation may have a role in the formation of cellular memory – but not in the same sense as in other cells in the body – where cells remember to remain in a terminally differentiated state.

In the brain, this epigenetic machinery may help cells remember stuff that’s more germane to brain function … you know … our memories and stuff.

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

As far as science movies go, the new movie, “To Age or Not To Age” seems like a lot of fun.  The interview with Dr. Leonard Guarente suggests that the sirtuin genes play a starring role in the film.  Certainly,  an NAD+ dependent histone deacetylase – makes for a sexy movie star – especially when it is able to sense diet and metabolism and establish the overall lifespan of an organism.

One comment in the movie trailer, by Aubrey de Grey, suggests that humans may someday be able to push the physiology of aging to extreme ends.  That studies of transgenic mice over-expressing SIRT1 showed physiological properties of calorie-restricted (long lived) mice – even when fed ad libitum – suggests that something similar might be possible in humans.

Pop a pill and live it up at your local Denny’s for the next 100 years?  Sounds nice (& a lot like grad school).

Just a few twists to the plot here.  It turns out that – in the brain – SIRT1 may not function as it does in the body.  Here’s a quote from a research article “Neuronal SIRT1 regulates endocrine and behavioral responses to calorie restriction” that inactivated SIRT1 just in the brain:

Our findings suggest that CR triggers a reduction in Sirt1 activity in hypothalamic neurons governing somatotropic signaling to lower this axis, in contrast with the activation of Sirt1 by CR in many other tissues. Sirt1 may have evolved to positively regulate the somatotropic axis, as it does insulin production in β cells, to control mammalian health span and life span in an overarching way. However, the fact that Sirt1 is a positive regulator of the somatotropic axis may complicate attempts to increase murine life span by whole-body activation of this sirtuin.

To a limited extent, it seems that – in the brain – SIRT1 has the normal function of promoting aging.  Therefore, developing “pills” that are activators of SIRT1 would be good for the body, but somehow might be counteracted by what the brain would do.  Who’s in charge anyway?  Mother Nature will not make it easy to cheat her! Another paper published recently also examined the role of SIRT1 in the brain and found that – normally – SIRT1 enhances neuronal plasticity (by blocking the expression of a  micro-RNA miR-134 that binds to the mRNA of, and inhibits the translation of, synaptic plasticity proteins such as CREB).

So, I won’t be first to line up for SIRT1 “activator” pills (such as Resveratrol), but I might pop a few if I’m trying to learn something new.

The current buzz about about GWAS  and longevity and GWAS in general has stirred up many longstanding inconvenient issues that arise when trying to interpret the results of very large, expensive and worthwhile genetic studies.  Its seems that Mother Nature does not give up her secrets without a fight.

One of the most common “inconvenient issues” is the fact that so many of the SNPs that come out of these studies are located far away from protein-encoding exons.  This ubiquitous observation is almost always followed with, “well, maybe its in linkage disequilibrium with a more functional SNP” or something along these lines – wherein the authors get an automatic pass.  OK by me.

Another “inconvenient issue” is the fact that many of these SNPs are of minimal effect and don’t exactly add up or interact to account for the expected heritability.  This problem of “missing heritability” is a big one (see some new insights in the latest issue of Nature Genetics) leading many to suspect that the effects of genes are dependent on complex interactions with each other and the environment.

A recent paper, “A map of open chromatin in human pancreatic islets” [doi:10.1038/ng.530] by Gaulton and colleagues caught my eye because it seems to shed light on both of these particular inconvenient issues.  The authors find that the diabetes risk variant rs7903146 in the TCF7L2 gene is both located in an intron and subject to epigenetic regulation (our sedentary, high-fat, high-stress lives can potentially interact with the genome by causing epigenetic change).

It appears that the T-allele of the intronic rs7903146 is correlated with a more open, transcription-prone form of DNA/chromatin than is the C-allele. The authors confirmed this using both chromatin mapping and gene expression assays on pancreatic islet cells harvested from non-diabetic donors and islet cell-lines.  The results suggest that the risk-conferring T-allele of this intronic SNP may be driving expression (gain-of-function) of the TCF7L2 gene.  What types of environmental stimuli might also impact the opening and closing of chromatin at this location?

This type of interplay of environment, genome and epigenome is probably rampant in the area of brain and behavior – so perhaps the study of diabetes will provide some clues to the many GWAS SNPs that are far away from exons. More on the genetics of epigenetics here.

pointer to the NOVA program on epigenetics “Ghost in Your Genes” (YouTube link here).  Fantastic footage.  Great intro to epigenetics and so-called trans-generational effects and the inheritance of epigenetic marks – which, in some cases – are left by adverse or stressful experience.  A weird, wild, game-changing concept indeed – that my grandchildren could inherit epigenetic changes induced in my genome by adverse experience.

In an earlier post on Williams Syndrome, we delved into the notion that sometimes a genetic variant can lead to enhanced function – such as certain social behaviors in the case of WS.  A mechanism that is thought to underlie this phenomenon has to do with the way in which information processing in the brain is widely distributed and that sometimes a gene variant can impact one processing pathway, while leaving another pathway intact, or even upregulated.  In the case of Williams Syndrome a relatively intact ventral stream (“what”) processing but disrupted dorsal stream (“where”) processing leads to weaker projections to the frontal cortex and amygdala which may facilitate gregarious and prosocial (a lack of fear and inhibition) behavior.  Other developmental disabilities may differentially disrupt these 2 visual information processing pathways.  For instance, developmental dyspraxia contrasts with WS as it differentially disrupts the ventral stream processing pathway.

A recent paper by Woodcock and colleagues in their article, “Dorsal and ventral stream mediated visual processing in genetic subtypes of Prader–Willi syndrome” [doi:10.1016/j.neuropsychologia.2008.09.019] ask how another developmental disability – Prader-Willi syndrome – might differentially influence the development of these information processing pathways.  PWS arises from the lack of expression (via deletion or uniparental disomy) of a cluster of paternally expressed genes in the 15q11-13 region (normally the gene on the maternally inherited chromosome is silent, or imprinted – related post here).  By comparing PWS children to matched controls, the team reports evidence showing that PWS children who carry the deletion are slightly more impaired in a task that depends on the dorsal “where” pathway whilst some sparing or relative strength in the ventral “what” pathway.

** PODCAST accompanies this post**

I have a little boy who loves to run and jump and scream and shout – a lot.  And by this, I mean running – at full speed and smashing his head into my gut,  jumping – off the couch onto my head,  screaming – spontaneous curses and R-rated body parts and bodily functions.  I hope you get the idea.  Is this normal? or (as I oft imagine) will I soon be sitting across the desk from a school psychologist pitching me the merits of an ADHD diagnosis and medication?

Of course, when it comes to behavior, there is not a distinct line one can cross from normal to abnormal.  Human behavior is complex, multi-dimensional and greatly interpreted through the lens of culture.  Our present culture is highly saturated by mass-marketing, making it easy to distort a person’s sense of “what’s normal” and create demand for consumer products that folks don’t really need (eg. psychiatric diagnoses? medications?).   Anyhow, its tough to know what’s normal.  This is an important issue to consider for those (mass-marketing hucksters?) who might be inclined to promote genetic data as “hard evidence” for illness, disorder or abnormality of some sort.

With this in mind, I really enjoyed a recent paper by Stollstorff et al., “Neural response to working memory load varies by dopamine transporter genotype in children” [doi:10.1016/j.neuroimage.2009.12.104] who asked how the brains of healthy children functioned, even though they carry a genotype that has been widely associated with the risk of ADHD.  Healthy children who carry genetic risk for ADHD. Hmm, might this be my boy?

The researchers looked at a 9- vs. 10-repeat VNTR polymorphism in the 3′-UTR of the dopamine transporter gene (DAT1).  This gene – which encodes the very protein that is targeted by so many ADHD medications – influences the re-uptake of dopamine from the synaptic cleft.  In the case of 10/10 genotypes, it seems that DAT1 is more highly expressed, thus leading to more re-uptake and hence less dopamine in the synaptic cleft.  Generally, dopamine is needed to enhance the signal/noise of neurotransmission, so – at the end of the day – the 10/10 genotype is considered less optimal than the 9/9-repeat genotype.  As noted by the researchers, the ADHD literature shows that the 10-repeat allele, not the 9-repeat, is most often associated with ADHD.

The research team asked these healthy children (typically developing children between 7 and 12 years of age) to perform a so-called N-back task which requires that children remember words that are presented to them one-at-a-time.  Each time a new word is presented, the children had to decide whether that word was the same as the previous word (1-back) or the previous, previous word (2-back).  Its a maddening task and places an extreme demand on neural circuits involved in active maintenance of information (frontal cortex) as well as inhibition of irrelevant information that occurs during updating (basal ganglia circuits).

As the DAT1 protein is widely expressed in the basal ganglia, the research team asked where in the brain was variation in the DAT1 (9- vs. 10-repeat) associated with neural activity?  and where was there a further difference between 1-back and 2-back?  Indeed, the team finds that brain activity in many regions of the basal ganglia (caudate, putamen, substantia nigra & subthalamic nucleus) were associated with genetic variation in DAT1.  Neat!  the gene may be exerting an influence on brain function (and behavior) in healthy children, even though they do not carry a diagnosis.  Certainly, genes are not destiny, even though they do influence brain and behavior.

What was cooler to me though, is the way the investigators examined the role of genetic variation in the 1-back (easy or low load condition) vs. 2-back (harder, high-load condition) tasks.  Their data shows that there was less of an effect of genotype on brain activation in the easy tasks.  Rather, only when the task was hard, did it become clear that the basal ganglia in the 10/10 carriers was lacking the necessary brain activation needed to perform the more difficult task.  Thus, the investigators reveal that the genetic risk may not be immediately apparent under conditions where heavy “loads” or demands are not placed on the brain.  Cognitive load matters when interpreting genetic data!

This result made me think that genes in the brain might be a lot like genes in muscles.  Individual differences in muscle strength are not associated with genotype when kids are lifting feathers.  Only when kids are actually training and using their muscles, might one start to see that some genetically advantaged kids have muscles that strengthen faster than others.  Does this mean there is a “weak muscle gene” – yes, perhaps.  But with the proper training regimen, children carrying such a “weak muscle gene” would be able to gain plenty of strength.

I guess its off to the mental and physical gyms for me and my son.

** PODCAST accompanies this post** also, here’s a link to the Vaidya lab!