Image by The Library of Congress via Flickr

Nope …

“On mathematical grounds, it is difficult to understand how 10-to-the-14th synaptic connections in the human brain could be controlled by a genome with approximately 10-to-the-6th genes.”

“… the classic dichotomy between “hard-wired” nativism and the “plasticity” championed by anti-nativists was woefully off the mark. Historically, “Anti-nativists”—critics of the view that we might be born with significant mental structure prior to experience—have often attempted to downplay the significance of genes by appealing to neural plasticity, viz. the brain’s resilience to damage and its ability to modify itself in response to experience, while nativists often seem to think that their position rests on downplaying (or demonstrating limits on) plasticity.”

Well, sort of … think of genes as used for pre-wiring while experience then shapes the pre-wired system.

“… it may be more profitable to draw a distinction, between prewiring and rewiring—each of which can be had in abundance without precluding the other.”

Probably not

In order to identify phenotype constructs that may ultimately be successful in genetic association studies, the field needs to move beyond the now traditional endophenotype approach and begin to build and refine multivariate multilevel phenotype models.

Check out the paper here and the super-cool PubMed exploration tools … especially PubAtlas.

“The historical lack of success in genetic studies of complex disease can largely be attributed, not to ignored biological interactions, but rather to under-powered studies that surveyed only a fraction of genetic variation …”

thanks for the pic heckyeahart

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

just a pointer to: Genetic Future’s pointer to the recent article, “Family become first to have DNA sequenced for non-medical reasons“.    The father suggests, “it will be ethically improper if you don’t have your children sequenced“.

Early days.

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension“  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar

It sounds simple on paper – just collect lots of folks with disorder X and look at their genomes in reference to a demographically matched healthy control population.  Voila! whatever is different is a candidate for genetic risk.  Apparently, not so.

The missing heritability problem that clouds the birth of the personal genomes era refers to the baffling inability to find enough common genetic variants that can account for the genetic risk of an illness or disorder.

There are any number of reasons for this … (i) even as any given MZ and DZ twin pair shares genetic variants that predispose them toward the similar brains and mental states, it may be the case that different MZ and DZ pairs have different types of rare genetic variation thus diluting out any similar patterns of variation when large pools of cases and controls are compared …  (ii) also, the way that the environment interacts with common risk-promoting genetic variation may be quite different from person to person – making it hard to find variation that is similarly risk-promoting in large pools of cases and controls … and many others I’m sure.

One research group recently asked whether the type of common genetic variation(SNP vs. CNV) might inform the search for the missing heritability.  The authors of the recent paper, “Genome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls” [doi:10.1038/nature08979] looked at an alternative to the usual SNP markers – so called common copy number variants (CNVs) – and asked if these markers might provide a stronger accounting for genetic risk.  While a number of previous papers in the mental health field have indeed shown associations with CNVs, this massive study (some 3,432 CNV probes in 2000 or so cases and 3000 controls) did not reveal an association with bipolar disorder.  Furthermore, the team reports that common CNV variants are already in fairly strong linkage disequilibrium with common SNPs and so perhaps may not have reached any farther into the abyss of rare genetic variation than previous GWAS studies.

Disappointing perhaps, but a big step forward nonetheless!  What will the personal genomes era look like if we all have different forms of rare genetic variation?

This past friday, I attended my first meditation session at my new yoga school.  I love this school and hope – someday – to make it through the full Ashtanga series and other sequences the instructors do.  In the meantime, I found myself sitting on my folded up blanket, letting my mind wander, listening to my breath and just trying to enjoy the moment.

What a wonderful experience it was … it felt great!  … I think I my have even given my brain a rest. A simple kindness to repay it for all it has done for me!

Although I did not know what I was supposed to be “doing” during meditation, the experience itself has me hooked and fascinated with a new research article, “Genetic control over the resting brain” [doi: 10.1073/pnas.0909969107]  by David Glahn and colleages.

Reading this paper, I learned that my brain “at rest” is really very active with neural activity in a series of interconnected circuits known as the default network.  Moreover, the research team finds that many of these interconnected circuits fire together in a way that is significantly influenced by genetic factors (overall heritability of about 0.42).  By analyzing the resting state (lay in the MRI and let your mind wander) patterns of activity in 333 folks from extended pedigrees, the team shows that certain interconnections (neural activity between 2 or more regions) within the default network are more highly correlated in people who are more related to each other.  For example, the left parahippocampal region was genetically correlated with many of the other brain areas in the default network.

Of course, these genetic effects on resting state connectivity are far from determinative, and the authors noted that some interconnections within the default network were more sensitive to environmental factors – such as functional connectivity between right temporal-parietal & posterior cingulate/precuneus & medial prefronal cortex.

Wow, so my resting state activity must – at some level – as a partial product of my genome – be rather unique and special.  It certainly felt that way as my mind wandered freely during meditation class. The authors point out that their heritability study lays more groundwork for follow-up gene hunting expeditions to isolate specific genetic variants.  This will be very exciting!

Some other items from their paper that I’ll be pondering in my next meditation class are the facts that these default neural networks are already present in the infant brain!  and in our non-human primate cousins (even when they are not conscious)!  Whoa!  These genetics & resting-state brain studies will really push our sense of what it means to be human, to be unique, to be interconnected by a common (genetic) thread from generation to generation over vast spatial and temporal distances (is this karma of sorts?).

I suppose yogis & other practitioners of meditation might be bemused at this recent avenue of “cutting edge” scientific inquiry – I mean – duh?!  of course, it makes sense that by remaining calm and sitting quietly that we would discover ourselves.

Related posts here, here, here

Reading the book makes me feel liberated from the medical labels that are all too readily slapped on healthy people.  There is much that is healthy about sadness and many reasons and contexts in which its quite natural.  From now on, instead of trying to escape from, or rid myself of sadness, I will embrace it and let myself feel it and work through it.  Who knows, maybe this is a good first step in a healthy coping process.

If depressed emotional states are more a part of the normal range of emotions (rather than separate disordered states) then does this allow us to make predictions about the underlying genetic bases for these states?    Perhaps not.   However, on page 172, the authors apply their critical view to the highly cited Caspi et al., article (showing that 5HTT genotype interacts with life stress in the presentation of depressive illness – critiqued here).  They note that the incidence of depression at 17% in the sample is much too high – most certainly capturing a lot of normal sadness.  Hence, the prevalent short allele in the 5HTT promoter might be better thought of as a factor that underlies how healthy people respond to social stress – rather than as a drug target or risk factor for psychiatric illness.

In an effort to discover genes that contribute to individual differences in brain structure, the authors took on the task of statistically analyzing the some 31,622 voxels (per brain) obtained from high-resolution structural brain scans; with 448,293 Illumina SNP genotypes (per person) with minor allele frequencies greater than 0.1 (common variants); in 740 unrelated healthy caucasian adults.  When performed on a voxel-by-voxel basis, this amounts to some 14 billion statistical tests.

Yikes!  A statistical nightmare with plenty of room for false positive results, not to mention the recent disillusionment with the common-variant GWAS approach?  Certainly.  The authors describe these pitfalls and other scenarios wherein false data is likely to arise and most of the paper addresses the pros and cons of different statistical analysis strategies – some which are prohibitive in their computational demands.  Undaunted, the authors describe several approaches for establishing appropriate thresholds and then utilize a ‘winner take all’ analysis strategy wherein a single ‘most-associated winning snp’ is identified for each voxel, which when clustered together in hot spots (at P = 2 x 10e-10), can point to specific brain areas of interest.

Using this analytical approach, the authors report that 8,212 snps were identified as ‘winning, most-associated’ snps across the 31,622 voxels.  They note that there was not as much symmetry with respect to winning snps in the left hemispere and corresponding areas in the right hemisphere, as one might have expected.  The 2 most significant snps across the entire brain and genome were rs2132683 and rs713155 which were associated with white matter near the left posterior lateral ventricle.  Other notable findings were rs2429582 in the synaptic (and possible autism risk factor) CADPS2 gene which was associated with temporal lobe structure and rs9990343 which sits in an intergenic region but is associated with frontal lobe structure.  These and several other notable snps are reported and brain maps are provided that show where in the brain each snp is associated.

As in most genome-wide studies, one can imagine that the authors were initially bewildered by their unexpected findings.  None of the ‘usual suspects’ such as neurotransmitter receptors, transcription factors, etc. etc. that dominate the psychiatric genetics literature.  Bewildered, perhaps, but maybe thats part of the fun and excitement of discovery!  Very exciting stuff to come I’ll bet as this new era unfolds!