One of the best research teams in the business performed a genomewide association study (GWAS) of neuroticism in 1,227 US Caucasion participants and found associations (P values of 10−5 to 10−6) with several markers – including rs7151262 in the MAMDC1 gene.  Later they replicated the finding in a German sample of 1,880 (P values in the same directions 0.006–0.025).

Very exciting to ponder the ways in which this SNP might relate to the development of brain systems that process emotional information!

More recently, they attempted another replication of the MAMDC1 gene for association with neuroticism in 2,722 US Caucasion participants.  This time they report, “the current analysis failed to detect a significant association signal“.

Some 5,829 people were involved in the research and the data suggest that rs7151262 may or may not contribute to one’s neurotic tendencies.  If you knew your rs7151262 genotype would it change the way you think about yourself?

I don’t know … the confusion over the (+) vs. (-) association data would make me … well, neurotic.

thanks for the photo jinxmesomethingcrazy.

Pointer to … “50 Resources for Students Attending Online Health Psychology Schools” @ Online Schools .org which lists this blog as a resource.  From this site:

Health psychology news and information allows online students and professionals to understand the goings on in the health industry. The information makes it possible for one to learn what steps are being taken to provide better mental health care, what is going on in psychology health research, treatment and medicine.

Hope the blog will be useful.  More (and more frequent) posts to come!

As a parent, there are times when I realize that the world of my children is not the world I grew up in.  Yes, the Readin’, ‘Ritin’ & ‘Ritmetic are still just as important … and there is nothing as precious as apple pie and little league in the spring … and yes, kids must eat their vegetables and say their prayers at night.  Just as its always been – and will always be.  The wider technological and economic world of my children, however, is much different – most obviously altered by the recent rise of computer technology that “creatively destroys” all forms of industrial activity (media, finance, trade, healthcare) across the globe.  Such change, while unsettling, is, itself, nothing new.  Just teach the children to adapt and, like every generation before, your children will be fine.  OK.

With this in mind, I enjoyed the recent NY Times article, “Outdoors and Out of Reach, Studying the Brain” that describes a rafting expedition of neuroscientists who ventured down a remote river in Utah – purposefully out of touch with computer technology – in order to ponder how computer technology, in the form of our email, video gaming, texting etc., etc. shape our mental experience and mental health.  According to the article:

It was a primitive trip with a sophisticated goal: to understand how heavy use of digital devices and other technology changes how we think and behave, and how a retreat into nature might reverse those effects.

In particular, the team was focused on the neural systems that help us pay attention.

David Strayer, a psychology professor at the University of Utah, says that studying what happens when we step away from our devices and rest our brains — in particular, how attention, memory and learning are affected — is important science.  “Attention is the holy grail,” Mr. Strayer says.”  “Everything that you’re conscious of, everything you let in, everything you remember and you forget, depends on it.

Every parent knows that kids are increasingly hooked on this and that computer device.  We know that these devices constantly serve up all manner of entertaining news, sports scores, gossip, visual images, games, etc. etc.    Unfortunately, we also know that so-called “intermittent reinforcement”, “variable ratio of reinforcement” or “random reinforcement” can be just as addictive as any drug (the red line in the chart here shows how much more reinforcing “random” rewards are than fixed, predictable rewards).  This is why these devices are – in every sense of the word – ADDICTIVE.  They offer up a steady, but unpredictably so, stream of rewarding images and bits of information.  I mean, how many times a day do you check your email and favorite websites?  Do you feel disappointed when there is nothing juicy – but can’t help checking “just one more time”?

Hence, computer technology presents a quandary for all of us – grown ups and kids alike.  How to adapt to, and manage this “new normal” of hand-held, computer-based, ubiquitous access to social and entertainment information?

Although the trip did not yield THE definitive answer, it seemed to prompt the scientists to take a closer look at the effects and value of conecting/disconnecting from computer technology.  For Professor Todd Braver, a neuroscientist from Washington University:

When he gets back to St. Louis, he says, he plans to focus more on understanding what happens to the brain as it rests. He wants to use imaging technology to see whether the effect of nature on the brain can be measured and whether there are other ways to reproduce it, say, through meditation.

Boy, it sure would be nice to head out with the kids and shoot the rapids for a few days every time I felt overloaded!  Unfortunately NOT one our our family’s economic realities!

Professor Braver’s comments on reproducing the effect of the rafting trip through meditation, however, got me wondering, and also reminded me of a quote that is painted on the wall of my yoga shala – from the 13th century Persian poet, Rumi.

“When you do things from your soul, you feel a river moving in you, a joy”

Although I can’t get away with the kids for a rafting trip, I can – and do – enjoy spending time together in a place where “CrackBerrys” and all other forms of digital technology are not to be found.  A quiet spot in NJ near the, ahem, scenic Rahway River.  One thing my kids have been learning in their children’s yoga classes are the rudiments of mindfulness meditation.  Might this be what Professor Braver had in mind?  Can it help reproduce the cognitive and emotional effects of a river rafting trip?  As noted in the article:

Mr. Strayer, the trip leader, argues that nature can refresh the brain. “Our senses change. They kind of recalibrate — you notice sounds, like these crickets chirping; you hear the river, the sounds, the smells, you become more connected to the physical environment, the earth, rather than the artificial environment.”  … “There’s a real mental freedom in knowing no one or nothing can interrupt you,” Mr. Braver says. He echoes the others in noting that the trip is in many ways more effective than work retreats set in hotels, often involving hundreds of people who shuffle through quick meetings, wielding BlackBerrys.”

Hmmm, this kind of stuff is oft said about meditation.  As many parents fret about their way kids become attached to their digital devices, it is perhaps too early to know whether meditation is an effective counter-balance to the new digital reality.  Can it provide the same cognitive and emotional benefits experienced by the river rafters who were truly “disconnected” for a few days?  Perhaps – with practice, and more practice.  Nevertheless, a relaxing walk through the forest is different for kids today – as their digital devices buzz away in their pockets.  What’s a modern-age kid to do?

To begin to explore this question further, check out these 2 review articles on the physiological and psychological benefits of both meditation and yoga in children.  The first, Sitting-Meditation Interventions Among Youth: A Review of Treatment Efficacy by David S. Black, Joel Milam and Steve Sussman, published in Pediatrics Aug 24, 2009  and Therapeutic Effects of Yoga for Children: A Systematic Review of the Literature by doctors Mary Lou Galantino, Robyn Galbavy and Lauren Quinn from the University of Pennsylvania.

Both articles examine existing scientific evidence – in the form of controlled clinical studies – on whether these very ancient practices provide benefits to kids in the modern world.  In short – they do – but more research is needed to better understand how much benefit is provided.  How many sessions are needed?  Does it last after practicing stops?  How do the benefits work?  How to best engage children of different ages?  From the abstracts:

“Sitting meditation seems to be an effective intervention in the treatment of physiologic, psychosocial, and behavioral conditions among youth.” … “The evidence shows physiological benefits of yoga for the pediatric population that may benefit children through the rehabilitation process, but larger clinical trials, including specific measures of quality of life are necessary to provide definitive evidence.”

Its fun to meditate and fun to spend quiet time with my young children – so there is no real downside to spending some time meditating and “disconnecting” from our digital devices.  Might they be learning a skill that protects their creativity and emotional well-being?  I hope so.  Perhaps one day when they are older, they will email me to let me know!

To learn more about meditation for children, visit The David Lynch Foundation,  UCLA Mindful Awareness Research Center (adapting ancient practices to modern life),  the Committee for Stress-Free Schools, Dr. Elizabeth Reid’s six week curriculum to encourage mindful learning in a class of fourth grade students and an interview with my former postdoctoral mentor on the science of attention training.

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension“  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar

It sounds simple on paper – just collect lots of folks with disorder X and look at their genomes in reference to a demographically matched healthy control population.  Voila! whatever is different is a candidate for genetic risk.  Apparently, not so.

The missing heritability problem that clouds the birth of the personal genomes era refers to the baffling inability to find enough common genetic variants that can account for the genetic risk of an illness or disorder.

There are any number of reasons for this … (i) even as any given MZ and DZ twin pair shares genetic variants that predispose them toward the similar brains and mental states, it may be the case that different MZ and DZ pairs have different types of rare genetic variation thus diluting out any similar patterns of variation when large pools of cases and controls are compared …  (ii) also, the way that the environment interacts with common risk-promoting genetic variation may be quite different from person to person – making it hard to find variation that is similarly risk-promoting in large pools of cases and controls … and many others I’m sure.

One research group recently asked whether the type of common genetic variation(SNP vs. CNV) might inform the search for the missing heritability.  The authors of the recent paper, “Genome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls” [doi:10.1038/nature08979] looked at an alternative to the usual SNP markers – so called common copy number variants (CNVs) – and asked if these markers might provide a stronger accounting for genetic risk.  While a number of previous papers in the mental health field have indeed shown associations with CNVs, this massive study (some 3,432 CNV probes in 2000 or so cases and 3000 controls) did not reveal an association with bipolar disorder.  Furthermore, the team reports that common CNV variants are already in fairly strong linkage disequilibrium with common SNPs and so perhaps may not have reached any farther into the abyss of rare genetic variation than previous GWAS studies.

Disappointing perhaps, but a big step forward nonetheless!  What will the personal genomes era look like if we all have different forms of rare genetic variation?

This past friday, I attended my first meditation session at my new yoga school.  I love this school and hope – someday – to make it through the full Ashtanga series and other sequences the instructors do.  In the meantime, I found myself sitting on my folded up blanket, letting my mind wander, listening to my breath and just trying to enjoy the moment.

What a wonderful experience it was … it felt great!  … I think I my have even given my brain a rest. A simple kindness to repay it for all it has done for me!

Although I did not know what I was supposed to be “doing” during meditation, the experience itself has me hooked and fascinated with a new research article, “Genetic control over the resting brain” [doi: 10.1073/pnas.0909969107]  by David Glahn and colleages.

Reading this paper, I learned that my brain “at rest” is really very active with neural activity in a series of interconnected circuits known as the default network.  Moreover, the research team finds that many of these interconnected circuits fire together in a way that is significantly influenced by genetic factors (overall heritability of about 0.42).  By analyzing the resting state (lay in the MRI and let your mind wander) patterns of activity in 333 folks from extended pedigrees, the team shows that certain interconnections (neural activity between 2 or more regions) within the default network are more highly correlated in people who are more related to each other.  For example, the left parahippocampal region was genetically correlated with many of the other brain areas in the default network.

Of course, these genetic effects on resting state connectivity are far from determinative, and the authors noted that some interconnections within the default network were more sensitive to environmental factors – such as functional connectivity between right temporal-parietal & posterior cingulate/precuneus & medial prefronal cortex.

Wow, so my resting state activity must – at some level – as a partial product of my genome – be rather unique and special.  It certainly felt that way as my mind wandered freely during meditation class. The authors point out that their heritability study lays more groundwork for follow-up gene hunting expeditions to isolate specific genetic variants.  This will be very exciting!

Some other items from their paper that I’ll be pondering in my next meditation class are the facts that these default neural networks are already present in the infant brain!  and in our non-human primate cousins (even when they are not conscious)!  Whoa!  These genetics & resting-state brain studies will really push our sense of what it means to be human, to be unique, to be interconnected by a common (genetic) thread from generation to generation over vast spatial and temporal distances (is this karma of sorts?).

I suppose yogis & other practitioners of meditation might be bemused at this recent avenue of “cutting edge” scientific inquiry – I mean – duh?!  of course, it makes sense that by remaining calm and sitting quietly that we would discover ourselves.

Related posts here, here, here

Reading the book makes me feel liberated from the medical labels that are all too readily slapped on healthy people.  There is much that is healthy about sadness and many reasons and contexts in which its quite natural.  From now on, instead of trying to escape from, or rid myself of sadness, I will embrace it and let myself feel it and work through it.  Who knows, maybe this is a good first step in a healthy coping process.

If depressed emotional states are more a part of the normal range of emotions (rather than separate disordered states) then does this allow us to make predictions about the underlying genetic bases for these states?    Perhaps not.   However, on page 172, the authors apply their critical view to the highly cited Caspi et al., article (showing that 5HTT genotype interacts with life stress in the presentation of depressive illness – critiqued here).  They note that the incidence of depression at 17% in the sample is much too high – most certainly capturing a lot of normal sadness.  Hence, the prevalent short allele in the 5HTT promoter might be better thought of as a factor that underlies how healthy people respond to social stress – rather than as a drug target or risk factor for psychiatric illness.

If you’ve started to notice the arrival of spring blossoms, you may have wondered, “how do the blossoms know when its spring?“  Well, it turns out that its not the temperature, but rather, that plants sense the length of the day-light cycle in order to synchronize their  own life cycles with the seasons.  According to the photoperiodism entry for wikipedia, “Many flowering plants use a photoreceptor protein, such as phytochrome or cryptochrome, to sense seasonal changes in night length, or photoperiod, which they take as signals to flower.”

It turns out that humans are much the same. Say wha?!

Yep, as the long ago descendants of single cells who had to eek out a living during day (when the sun emits mutagenic UV radiation) and night cycles, our very own basic molecular machinery that regulates the transcription, translation, replication and a host of other cellular functions is remarkably sensitive – entrained – in a clock-like fashion to the rising and setting sun.  This is because, in our retinas, there are light-sensing cells that send signals to the suprachiasmatic nucleus (SCN) which then – via the pineal gland – secretes systemic hormones such as melatonin that help synchronize cells and organs in your brain and body.  When this process is disrupted, folks can feel downright lousy, as seen in seasonal affective disorder (SAD), delayed sleep phase syndrome (DSPS) and other circadian rhythm disorders.

If you’re skeptical, consider the effects of genetic variation in genes that regulate our circadian rhythms, often called “clock” genes – very ancient genes that keep our cellular clocks synchronized with each other and the outside environment.  Soria et al., have a great paper entitled, “Differential Association of Circadian Genes with Mood Disorders: CRY1 and NPAS2 are Associated with Unipolar Major Depression and CLOCK and VIP with Bipolar Disorder” [doi: 10.1038/npp.2009.230] wherein they reveal that normal variation in these clock genes is associated with mood regulation.

A few of the highlights reported are rs2287161 in the CRY1 gene,  rs11123857 in the NPAS2 gene, and rs885861 in the VIPR2 gene – where the C-allele, G-allele and C-allele, respectively, were associated with mood disorders.

I’m not sure how one would best interpret genetic variation of such circadian rhythm genes.  Perhaps they index how much a person’s mood could be influenced by changes or disruptions to the normal rhythm??  Not sure.  My 23andMe data shows the non-risk AA genotype for rs11123857 (the others are not covered by 23andMe).

Obviously, Wolfe was a gifted artist, despite whatever psychiatric diagnosis was suggested at the time.  Nevertheless, clinical psychiatrists might be quick to point out that such work reflects the presence of an underlying thought disorder (loss of abstraction ability, tangentiality, loose associations, derailment, thought blocking, overinclusive thinking, etc., etc.) – despite the undeniable aesthetic beauty in the work.  As an ardent fan of such art,  it made me wonder just how “well ordered” my own thoughts might be.  Given to being rather forgetful and distractable, I suspect my thinking process is just sufficiently well ordered to perform the routine tasks of day-to-day living, but perhaps not a whole lot more so.  Is this bad or good?  Who knows.

However, Krug et al., in their recent paper, “The effect of Neuregulin 1 on neural correlates of episodic memory encoding and retrieval” [doi:10.1016/j.neuroimage.2009.12.062] do note that the brains of unaffected relatives of persons with mental illness show subtle differences in various patterns of activation.  It seems that when individuals are using their brains to encode information for memory storage, unaffected relatives show greater activation in areas of the frontal cortex compared to unrelated subjects.  This so-called encoding process during episodic memory is very important for a healthy memory system and its dysfunction is correlated with thought disorders and other aspects of cognitive dysfunction.  Krug et al., proceed to explore this encoding process further and ask if a well-known schizophrenia risk variant (rs35753505 C vs. T) in the neuregulin-1 gene might underlie this phenomenon.  To do this, they asked 34 TT, 32 TC and 28 CC individuals to perform a memory (of faces) game whilst laying in an MRI scanner.

The team reports that there were indeed differences in brain activity during both the encoding (storage) and retrieval (recall) portions of the task – that were both correlated with genotype – and also in which the CC risk genotype was correlated with more (hyper-) activation.  Some of the brain areas that were hyperactivated during encoding and associated with CC genotype were the left middle frontal gyrus (BA 9), the bilateral fusiform gyrus and the left middle occipital gyrus (BA 19).  The left middle occipital gyrus showed gene associated-hyperactivation during recall.  So it seems, that healthy individuals can carry risk for mental illness and that their brains may actually function slightly differently.

As an ardent fan of Art Brut, I confess I hoped I would carry the CC genotype, but alas, my 23andme profile shows a boring TT genotype.  No wonder my artwork sucks.  More on NRG1 here.