Feeds:
Posts
Comments

Posts Tagged ‘Brain’

Still the patterning of consciousness! The Yog...
Image via Wikipedia

The yoga sutras are a lot of fun to read – especially the super-natural ones.  I try not to take them too literally, as you never know what might have been warped in translation, or perhaps included merely to inspire yogis to go the extra mile in their practices.

Occasionally, I come across articles in the science literature that reveal how truly weird and wild the human brain can be – and it strikes me – that maybe the ancient yogis were more in tune with the human mind than we “modern science” folks give them credit for.  Here’s a weird and wild sutra:

III.55 –  tarakam sarvavisayam sarvathavisayam akramam ca iti vivekajam jnanam – The essential characteristic of the yogi’s exalted knowledge is that he grasps instantly, clearly and wholly, the aims of all objects without going into the sequence of time of change.

How can we know things instantly?  and without respect to time (ie. never having had prior experience)?

Admittedly, Patanjali may be referring to things that take place in emotional, subconscious or cosmic realms that I’m not familiar with, so I won’t quibble with the text.  Besides, it sounds like an AWESOME state of mind to attain, and well worth the effort – even if we concede it is knowingly unobtainable.  But is it unobtainable?

Might there be states of mind that make it seem obtainable?  Here’s a fascinating science article that appeared in Science Magazine this past week.  Paradoxical False Memory for Objects After Brain Damage [doi: 10.1126/science.1194780] describing the effects of damage in the perirhinal cortex (in rats) that led the animals to demonstrate a peculiar form of false memory – wherein the animals treated never-before seen objects as being familiar. Hmmm.  An altered form of brain activity where unfamiliar and novel things seem very familiar.  Sounds sort of  like “instantaneous knowing without respect to time” to me.

Given the tremendous similarity in brain circuits and memory systems across all mammals, I wonder if humans (perhaps in deep meditative states or with various forms of hallucinogenic or damaged states) could experience this? Sutra III.55 seems strange, but not, perhaps unobtainable.

Enhanced by Zemanta

Read Full Post »

Your brain is a beautiful universe!  Enjoy it via meditation. Love it & spend time getting to know it.  Its a wonderful place!

 

Read Full Post »

Hatha Yoga Video - Revolving Lunge Pose
Image by myyogaonline via Flickr

Does yoga feel good?  Do you feel good during the practice – moving your body through the bending, twisting, inverting etc.?  Be honest. I mean, since you’re probably sore as hell the next morning … if you don’t feel good during the practice, why would you bother at all?

Now that I have a tad of strength in my arms and shoulders, I think I can say that, “yes” I do feel good and enjoy the practice … but usually just for the first 20 minutes or so before I start playing the frantic “just keep up with the instructor and hope for a break” game.

Some say that their good feelings come from the relaxed meditative state that yoga puts them in.  Some folks just like to move their bodies and are attracted to the strange and exotic beauty of the postures.  I always enjoy the music.

But where do these good feelings come from?   Aren’t they just in my head?  Do I really need to move my body to feel good?  Why not just sit and breathe?

It turns out that there is a scientific theory on this topic.  The so-called Somatic markers hypothesis that suggests that afferent feedback from the body to the brain is necessary for generating our feelings.  For example, stimulation of the vagus nerve (aka Kundalini serpent) makes us feel good, while individuals with spinal cord damage who lack afferent input from the body reportedly have blunted emotions.

In his research review article, Human feelings: why are some more aware than others? [doi:10.1016/j.tics.2004.04.004] Dr. Bud Craig from the Barrow Neurological Institute reviews the science of this topic and lays out the neural circuitry that goes from body to brain and is necessary for us to FEEL.

These feelings represent ‘the material me’, and so this broader concept of interoception converges with the so-called somatic-marker hypothesis of consciousness proposed by Damasio. In this proposal, the afferent sensory representation of the homeostatic condition of the body is the basis for the mental representation of the sentient self.  Recursive meta-representations of homeostatic feelings allow the brain to distinguish the inner world from the outer world. Most strikingly, degrees of conscious awareness are related to successive upgrades in the cortex (a target of visceral afferent activity), supplementary motor cortex (involved in manual responses), and bilateral insular cortices. This pattern supports the general view that a network of inter-related forebrain regions is involved in interoceptive attention and emotional feelings.

Amazingly, it seems that humans have evolved several unique adaptations that make us able to convert bodily sensation into self-awareness.

For instance, a novel cell type, the so-called spindle cell, is exclusively located in these regions of the human brain. Recent evidence indicates a trenchant phylogenetic correlation, in that spindle cells are most numerous in aged humans, but progressively less numerous in children, gorillas, bonobos and chimpanzees, and nonexistent in macaque monkeys. Notably, this phylogenetic progression also parallels the results of the mirror test for self-awareness.

The rapid development of right Anterior Insula within a brief evolutionary timescale suggests that nested interoceptive re-representations could be directly related to the advantages of advanced social interaction.

So it seems that we human beings rely on bodily awareness to attain emotional awareness.  This sounds very yogic and something the yoga practice helps to develop.  Feel your body –> feel your emotions!

 

Enhanced by Zemanta

Read Full Post »

A young woman and man embracing while outdoors.
Image via Wikipedia

Please forgive the absurd title here … its just a play on words from a flabby, middle-aged science geek who is as alluring to “the ladies” as an old leather boot.

Like a lot of males (with active fantasy lives I suppose), my interest was piqued by the recent headline, “What Do Women Really Want? Oxytocin” – based on a recent lecture at this years Society for Neuroscience annual conference.

Oxytocin is a small hormone that also modulates brain activity.  Many have referred it as the “Love Hormone” because it is released into the female brain during breastfeeding (where moms report feeling inextricably drawn to their infants), orgasm and other trust-building and social bonding experiences.  So, the premise of the title (from the male point of view), is a fairly simplistic – but futile – effort to circumvent the whole “social interaction thing” and reduce dating down to handy ways of raising oxytocin levels in females (voila! happier females more prone to social (ahem) bonding).

Of course, Mother Nature is not stupid.  Unless you are an infant, there is no “increase in oxytocin” without a prior “social bonding or shared social experience”.  Mother Nature has the upper hand here … no physical bonding without social binding first!

So, what the heck does this have to do with yoga?  Yes, its true that yoga studios are packed with friendly, health conscious females, but, the practice is mainly a solitary endeavor.  Aside from the chatter before and after class, and the small amount of oxytocin that is released during exercise, there is no social bonding going on that would release the so-called “love hormone”.  Thus, even though “women want yoga”, yoga class may not be the ideal location to “score with chicks”.

However, there may be one aspect of yoga practice that can facilitate social bonding (and hence oxytocin release).  One benefit of a yoga practice (as covered here, here) is an increased ability to “be present” – an improved ability to pay closer attention to your own thoughts and feelings, and also, the thoughts and feelings of another person.

The scientific literature is fairly rich in research showing a close relationship between attention, shared- or joint-attention, trust and oxytocin, and the idea is pretty obvious.  If you are really paying attention to the other person, and paying attention to your shared experience in the moment, the social bond will be stronger, more enjoyable and longer-lasting.  Right?

Soooo – if you want the oxytocin to flow – look your partner in the eye, listen to their thoughts, listen to your own reactions, listen to, and feel their breath as it intermingles with your own, feel their feelings and your own, slow-down and enjoy the minute details of the whole experience and be “right there, right now” with them.  Even if you’ve been with the same person for 40 years, each moment will be new and interesting.

Yoga will teach you how to do this.

Enhanced by Zemanta

Read Full Post »

Have you ever seen the list “100 Benefits of Meditation“?  Of course, many of these benefits are psychological. You know, things like: helps control own thoughts (#39) and helps with focus & concentration (#40).  But many of the 100 benefits are rather physical, bodily, physiological, immunological and even biochemical benefits (such as #16- reduction of free radicals, less tissue damage).

These are awesome claims, and I’ve certainly found that mediation helps me feel more emotionally balanced and physically relaxed,  but I’m wondering – from a hard science point of view – how legit some of these claims might be.  For example, “#12 Enhances the immune system“ – REALLY?  How might yoga and mediation enhance my immune system?

In a previous post on the amazing vagus nerve – the only nerve in your body that, like the ancient Kundalini serpent, rises from the root of your gut to the brain – AND – a nerve that is a key to the cure of treatment resistant depression – it was suggested that much of the alleviation of suffering that comes from yoga comes from the stimulation of this amazing nerve during postures and breathing.

Somehow, the ancient yogis really got it right when they came up with the notion of Kundalini serpent – so strange, but so cool!

I happened to stumble on a paper that explored the possibility that the vagus nerve might also play a role in mediating communication of the immune system and the brain – and thus provide a mechanism for “#12- Enhances the immune system” Here’s a quote from the article entitled, “Neural concomitants of immunity—Focus on the vagus nerve” [doi:10.1016/j.neuroimage.2009.05.058] by Drs. Julian F. Thayer and Esther M. Sternberg (Ohio State University and National Institute of Mental Health).

By the nature of its “wandering” route through the body the vagus nerve may be uniquely structured to provide an effective early warning system for the detection of pathogens as well as a source of negative feedback to the immune system after the pathogens have been cleared. … Taken together these parasympathetic pathways form what has been termed “the cholinergic anti-inflammatory pathway”

The scientists then investigate the evidence and possible mechanisms by which the vagus nerve sends immunological signals from the body to the brain and also back out to the immune system.  Its not a topic that is well understood, but the article describes several lines of evidence implicating the vagus nerve in immunological health.

So bend, twist, inhale and exhale deeply.  Stimulate your vagus nerve and, as cold and flu season arrives, awaken the serpent within!

Enhanced by Zemanta

Read Full Post »

Modified drawing of the neural circuitry of th...
Image via Wikipedia

You already know this, but when you are stressed out (chronic stress), your brain doesn’t work very well.  That’s right – just when you need it most – your brain has a way of letting you down!

Here are a few things that happen to the very cells (in the hippocampus) that you rely on:

– reorganization within mossy fiber terminals
– loss of excitatory glutamatergic synapses
– reduction in the surface area of postsynaptic densities
– marked retraction of thorny excrescences
– alterations in the lengths of the terminal dendritic segments of pyramidal cells
– reduction of the dorsal anterior CA1 area volume

Thanks brain!  Thanks neurons for abandoning me when I need you most!  According to this article, these cellular changes lead to, “impaired hippocampal involvement in episodic, declarative, contextual and spatial memory – likely to debilitate an individual’s ability to process information in new situations and to make decisions about how to deal with new challenges.” UGH!

Are our cells making these changes for a reason?  Might it be better for cells to remodel temporarily rather than suffer permanent, life-long damage?  Perhaps.  Perhaps there are molecular pathways that can lead the reversal of these allostatic stress adaptations?

Check out this recent paper: “A negative regulator of MAP kinase causes depressive behavior” [doi 10.1038/nm.2219]  the authors have identified a gene – MKP-1 – a phosphatase that normally dephosphorylates various MAP kinases involved in cellular growth, that, when inactivated in mice, produces animals that are resistant to chronic unpredictable stress.  Although its known that MKP-1 is needed to limit immune responses associated with multi-organ failure during bacterial infections, the authors suggest:

“pharmacological blockade of MKP-1 would produce a resilient of anti-depressant response to stress”

Hmmm … so Mother Nature is using the same gene to regulate the immune response (turn it off so that it doesn’t damage the rest of the body) and to regulate synaptic growth (turn it off – which is something we DON’T want to do when we’re trying to recover from chronic stress)?  Mother Nature gives us MKP-1 so I can survive an infection, but the same gene prevents us from recovering (finding happiness) from stress?

Of course, we do not need to rely only on pharmacological solutions.  Exercise & social integration are cited by these authors as the top 2 non-medication strategies.

Enhanced by Zemanta

Read Full Post »

remember a day before today
Image by DerrickT via Flickr

Most cells in your adult body are “terminally differentiated” – meaning that they have developed from stem cells into the final liver, or heart, or muscle or endothelial cell that they were meant to be.  From that point onward, cells are able to “remember” to stay in this final state – in part – via stable patterns of DNA methylation that reinforce the regulation of “the end state” of gene expression for that cell.  As evidence for this role of DNA methylation, it has been observed that levels of DNA methyl transferase (DNMT) decline when cells are fully differentiated and thus, cannot modify or disrupt their patterns of methylation.

NOT the case in the brain! Even though neurons in the adult brain are fully differentiated, levels of methyl transferases – DO NOT decline.  Why not? Afterall, we wouldn’t want our neurons to turn into liver cells, or big toe cells, would we?

One hypothesis, suggested by David Sweatt and colleagues is that neurons have more important things to “remember”.   They suggest in their fee and open research article, “Evidence That DNA (Cytosine-5) Methyltransferase Regulates Synaptic Plasticity in the Hippocampus” [doi: 10.1074/jbc.M511767200] that:

DNA methylation could have lasting effects on neuronal gene expression and overall functional state. We hypothesize that direct modification of DNA, in the form of DNA (cytosine-5) methylation, is another epigenetic mechanism for long term information storage in the nervous system.

By measuring methylated vs. unmethylated DNA in the promoter of the reelin and BDNF genes and relating this to electrophysiological measures of synaptic plasticity, the research team finds correlations between methylation status and synaptic plasticity.  More specifically, they find that zebularine (an inhibitor of DNMT) CAN block long-term potentiation (LTP), but NOT block baseline synaptic transmission nor the ability of synapses to fire in a theta-burst pattern (needed to induce LTP).

This suggests that the epigenetic machinery used for DNA methylation may have a role in the formation of cellular memory – but not in the same sense as in other cells in the body – where cells remember to remain in a terminally differentiated state.

In the brain, this epigenetic machinery may help cells remember stuff that’s more germane to brain function … you know … our memories and stuff.

Enhanced by Zemanta

Read Full Post »

Peter Mark Roget (Roget's Thesaurus)
Image by dullhunk via Flickr

On Fridays, after a regular practice session, our shala is open for quiet meditation.  This is a new experience for me, even as I’ve read much about the mental and physical health benefits accrued by experienced practitioners.  As someone who is totally exhausted after practice – indeed, I couldn’t move another muscle even if I wanted – I always think it will be easy to settle in, and pass 30 minutes  in quiet stillness.

Sure enough though, even as my body is spent and motionless, my mind starts to wander, and wander, and wander some more.  “Damn”, I think, “here we go again”. Just a few minutes in, and I’m losing a battle – with myself.  “This is going to be the longest 30 minutes of my life!” What to do?

Some experts say to simply LABEL your thoughts and feelings.  Just find a word to place on the thought or feeling – and then – let it go.  Does this really work?  How does this trick work?

Recent brain imaging studies seem to show that when a word is applied to a negative emotion,  the brain changes how it processes that emotion and shifts processing to neural systems that avoid centers of the brain (the amygdala, in particular) that send neural projections to our face, gut and heart (areas where we tend to physically “feel” our bad feelings).   It seems that our ability to use words is an important tool in how we cope with emotional experience.  Either we succumb to the storms of negative emotions that can well up inside us from time to time (and feel lousy inside), or we can manage these feelings – using our words – and feel less lousy inside.   Apparently, the use of words, alters neural processing – leading us to experience less tightening in the chest, clenching in the gut, etc.,  etc. than we would otherwise feel when negative emotions come over us.  One of the researchers, David Cresswell, remarks: “This is an exciting study because it brings together the Buddha‘s teachings – more than 2,500 years ago, he talked about the benefits of labeling your experience – with modern neuroscience.”

But this is easier said than done.

How do I label a thought?  How do I label an emotion?  I mean, “I feel, um, um, frustrated, lousy, anxious … crap … I’m not exactly sure how I feel?  What’s the word I’m looking for?”

Indeed – the words – the words – as in, “In the beginning was the Word, and the Word was with God, and the Word was God.” WORDS.  Do I know enough words?  How many words are there anyway to describe all the possible feelings that a person can feel?  How many do you know?

Check this list out.    There are more than 3,000 words in the English language to describe various feelings.  Thank you Peter Mark Roget (who, ironically, worked on the first thesaurus as a means to cope with negative feelings associated with depression).  I will bring my thesaurus – full of these tools to help me label my feelings – to meditation practice from now on!

Enhanced by Zemanta

Read Full Post »

gamma waves.
Image via Wikipedia

Have you ever wondered what is the proper musical note to sound when singing AUM at the beginning of class?

Tonight, I was blessed to chant along with Girish who led a kirtan at my yoga shala.  According to him, “AUM” is traditionally played using a low E-chord.  He played his low E chord on his harmonium and we chanted aum – again and again and again! He also said (just paraphrasing his informal comments tonight), that this E-chord is not just a random choice, but that its also the sound that comes from within our minds when we meditate.  Hmm, I wondered – cool thought indeed – but is he just making this up? I mean, what could he know (or ancient yogis for that matter) about what is really, actually happening in the mind?

It turns out that modern science can actually “listen” to the brain when it is meditating – by placing listening devices (small electrodes on the scalp) and measuring oscillations of neuro-electrical activity (electroencephalography or EEG).  Experienced meditators show an increase in the strength of one particular “note” or frequency – a so-called gamma wave, or gamma frequency of about 40Hz when they reach deep meditative states.  According to wikipedia:

A gamma wave is a pattern of brain waves in humans with a frequency between 25 to 100 Hz, though 40 Hz is prototypical. … Experiments on Tibetan Buddhist monks have shown a correlation between transcendental mental states and gamma waves.  A suggested explanation is based on the fact that the gamma is intrinsically localized. Neuroscientist Sean O’Nuallain suggests that this very existence of synchronized gamma indicates that something akin to a singularity – or, to be more prosaic, a conscious experience – is occurring.

OK, so modern science measures brain activity in deep meditators and finds that 40Hz is the vibration associated with deep meditative states.  Girish says AUM is also the vibration of deep meditative states and is traditionally a low E-chord.  OK, so then, is he right?  What’s the frequency of low E?  Is it 40Hz?

41.2Hz! Pretty darn amazing!

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Television icons
Image via Wikipedia

just a pointer to a great SciVee episode – Genetic Contribution To Variation In Cognitive Function In Twins

Their data suggest that genetic influences on cognitive function act outside of the brain areas most commonly activated during cognitive tasks.  The areas where genes seem to exert influence on brain activity are quite variable from person to person (which is why they don’t show up in group-level analyses).  Thus folks with different genetic variability use slightly different brain areas to accomplish the same cognitive task.

Enhanced by Zemanta

Read Full Post »

Artist's depiction of the separation stage. Th...
Image via Wikipedia

Once in class, while trying to get my arms up during Prasarita Padottanasana C (no hopes for “over” and “down to the floor” for me, just “up” with merely a slight forward bend) my instructor said that the first time she was able to touch her clasped hands to the floor, she felt like she “went out of her body”.   Lucky her! Wouldn’t that be cool! I thought to myself.  Maybe someday.

Could her experience – possibly – be akin to the experiences of early Vedic writers and yogis who practiced strange and difficult postures as part of their spiritual development?

The yoga sutras III.39 “bandhakarana saithilyat pracara samvedanat ca cittasya parasariravesah” (Through relaxation of the causes of bondage, and the free flow of consciousness, the yogi enters another’s body at will.)  and  III.40 “udanajayat jala panka kantakadisu asangah utkrantih ca” (By mastery of udana vayu, the yogi can walk over water, swamps and thorns without touching them.  He can also levitate.) – seem to tenuously address something like “being out of one’s body”.

What science research studies today – unknown to the ancient sages who may have experienced such states – are the various brain systems that can give rise to such experiences. The fancy scientific terms for hallucinations of separating from one’s body are heautoscopy and autoscopy and go by other more common terms such as doppelganger or just “out of body experiences”.  As reported in, “Brain electrodes conjure up ghostly visions“ (Nature, 2006) and in “Electrodes trigger out-of-body experience” (Nature, 2002):

Simple stimulation of the brain can cause the mind to play complex and creepy tricks on itself, neurologists have discovered. They found that, by inserting electrodes into a specific part of the brain [left temporoparietal junction], they could induce a patient to sense that an illusory ‘shadow person’ was lurking behind her and mimicking her movements.

People describe out-of-body experiences as feeling that their consciousness becomes detached from their body, often floating above it. … Blanke found that electrically stimulating one brain region — the right angular gyrus — repeatedly triggers out-of-body experiences. … The right angular gyrus integrates visual information — the sight of your body — and information that creates the mind’s representation of your body. This is based on balance and feedback from your limbs about their position in space.

So, the whole proposition of “out of body” seems less far-fetched to me,  perhaps there are possibilities to experience such states of mind – more plausible under conditions of neurological pathology – rather than during yoga practice.  But, something to meditate on in the years to come.

Enhanced by Zemanta

Read Full Post »

left parietal lobe(red) and corpus callosum, d...
Image via Wikipedia

The brain and mind changes that come with extensive yoga practice seem to increase inner awareness and – as many practitioners report – towards a more “spiritual” awareness.  What is this? … in terms of specific brain systems? One recent research article,  “The Spiritual Brain: Selective Cortical Lesions Modulate Human Self-Transcendence” has much to say on the types of brain systems that are engaged when we are experiencing connections to each other, our inner selves and other deeper, broader perspectives.

The researchers measured the self-transcendence scores of individuals before and after the removal of brain tissue (gliomas) in various parts of the brain – specifically the posterior parietal cortex.  It was interesting that the – removal – of certain areas of the brain resulted in – higher – scores for self-transcendence.  Perhaps this suggests that the effort made in yoga – to silence and still our mental processes – might have a roughly analogous effect of taking certain brain areas “offline”?  Could this be what is happening in yoga and meditation? – a quieting of the posterior parietal cortex?  Much to ponder and explore.

Combining pre- and post-neurosurgery personality assessment with advanced brain-lesion mapping techniques, we found that selective damage to left and right inferior posterior parietal regions induced a specific increase of self-transcendence. Therefore, modifications of neural activity in temporoparietal areas may induce unusually fast modulations of a stable personality trait related to transcendental self-referential awareness.

It is relevant that the posterior parietal cortex is involved in the representation of different aspects of bodily knowledge.  Lesions of the left posterior parietal cortex induce selective deficits in the representation of the spatial relationships between body segments and delusions regarding body parts occur after lesions centered on the right temporoparietal cortex. Furthermore, illusory localization of the self into the extrapersonal space has been reported in patients with left (heautoscopic phenomena) and right temporoparietal damage (out-of-body experiences). Thus, we posit that the reduction of neural activity in the temporoparietal cortex during spiritual experiences may reflect an altered sense of one’s own body in space.

A great review of this article and the psychological assessments used to quantify “self-transcendence” can be found at NeuroWhoa! and also at Neurophilosophy.

Enhanced by Zemanta

Read Full Post »

Cinematicode wall
Image by Smeerch via Flickr

As far as science movies go, the new movie, “To Age or Not To Age” seems like a lot of fun.  The interview with Dr. Leonard Guarente suggests that the sirtuin genes play a starring role in the film.  Certainly,  an NAD+ dependent histone deacetylase – makes for a sexy movie star – especially when it is able to sense diet and metabolism and establish the overall lifespan of an organism.

One comment in the movie trailer, by Aubrey de Grey, suggests that humans may someday be able to push the physiology of aging to extreme ends.  That studies of transgenic mice over-expressing SIRT1 showed physiological properties of calorie-restricted (long lived) mice – even when fed ad libitum – suggests that something similar might be possible in humans.

Pop a pill and live it up at your local Denny’s for the next 100 years?  Sounds nice (& a lot like grad school).

Just a few twists to the plot here.  It turns out that – in the brain – SIRT1 may not function as it does in the body.  Here’s a quote from a research article “Neuronal SIRT1 regulates endocrine and behavioral responses to calorie restriction” that inactivated SIRT1 just in the brain:

Our findings suggest that CR triggers a reduction in Sirt1 activity in hypothalamic neurons governing somatotropic signaling to lower this axis, in contrast with the activation of Sirt1 by CR in many other tissues. Sirt1 may have evolved to positively regulate the somatotropic axis, as it does insulin production in β cells, to control mammalian health span and life span in an overarching way. However, the fact that Sirt1 is a positive regulator of the somatotropic axis may complicate attempts to increase murine life span by whole-body activation of this sirtuin.

To a limited extent, it seems that – in the brain – SIRT1 has the normal function of promoting aging.  Therefore, developing “pills” that are activators of SIRT1 would be good for the body, but somehow might be counteracted by what the brain would do.  Who’s in charge anyway?  Mother Nature will not make it easy to cheat her! Another paper published recently also examined the role of SIRT1 in the brain and found that – normally – SIRT1 enhances neuronal plasticity (by blocking the expression of a  micro-RNA miR-134 that binds to the mRNA of, and inhibits the translation of, synaptic plasticity proteins such as CREB).

So, I won’t be first to line up for SIRT1 “activator” pills (such as Resveratrol), but I might pop a few if I’m trying to learn something new.

Enhanced by Zemanta

Read Full Post »

chakras
Image via Wikipedia

One thing that draws me to yoga, apart from other pure meditative practices, is that it places an emphasis on the body and mind, and not just the mind alone.  By paying attention to one’s diet, working diligently on postures and breathing, etc., there comes a transformation (still many years away for me) of both the body and the mind.  The concept of Kundalini seems to capture this – wherein a kind of psychic energy is awoken and driven slowly up through the spinal column and into the brain – releasing all sorts of desirable cognitive and physical benefits.

Transform the body and the mind will follow?

Today I was reminded of this when I saw a research article entitled, “A novel pathway regulates memory and plasticity via SIRT1 and miR-134” that was published in the prestigious scientific journal Nature.  In this article, the researchers examined a gene called SIRT1 which encodes a small protein that regulates the structure of chromosomes in response to the overall energy state of cells.  Most famously, it has been shown that SIRT1 mediates the longevity, cardiovascular and anti-inflammatory health benefits that occur when individuals observe a diet that is calorie restricted.

In his book on Ayurvedic medicine and Kundalini yoga, Sri Swami Sivananda remarks, not on SIRT1 (obviously), but on the importance of a calorie-restricted diet as a part of the long-standing commitment to certain virtuous observances or Niyama:

A glutton cannot at the very outset have diet regulations and observe Mitahara. He must gradually practise this. First let him take less quantity twice as usual. Then instead of the usual heavy night meals, let him take fruits and milk alone for some days. In due course of time he can completely avoid the night meals and try to take fruits and milk in the daytime. Those who do intense Sadhana must take milk alone. It is a perfect food by itself. If necessary they can take some easily digestible fruits.

Indeed, a restricted diet (but not a fasting state) is a part of the yoga practice.  This observance has long been known to confer tremendous bodily health benefits – that, it turns out, are mediated by SIRT1!  Indeed, if ever there were a “longevity gene” SIRT1 would be it.  When it is over-expressed (in mice) the mice show many of the same health benefits as seen in mice that are on calorie-restricted diets (even though the mice can eat as much as they want).  Conversely, when the gene is inactivated, the mice die early and are in poor health.

In any case, today’s research article takes the SIRT1 story from the body and pushes it upwards (like the awakening kundalini) to the mind.  The article demonstrates that overexpression of SIRT1 improves cognitive function while inactivation of SIRT1 in the brain lessens cognitive function.

So it seems that body and mind are ever more unified and that – even on the molecular level – what is good for one has benefits for the other.

Enhanced by Zemanta

Read Full Post »

An exploration of HOW mindfulness practices such as yoga and meditation transform the body and mind seems inextricably tied to the question of, “WHY, in the first place, would anyone want to sit for days and meditate?” What was it that motivated early humans and early civilizations to engage in these so-called “spiritual” practices?  Why does a practice like yoga engage people on a self-reflective or spiritual level?

As a biologist, I’d like to explore the mental and physical transformations that occur when one practices (and practices) yoga and meditation – so perhaps a place to begin this exploration is with a scientific hypothesis about the WHY, that in some ways might be testable insofar as it might point to certain mental and physical processes – which themselves – might function as targets or recipient processes that are engaged in the course of practice (the HOW).

As a humble start, here is one such hypothesis suggested by the biologist E. O. Wilson which is reviewed in the essay entitled, “The Biological Roots of Religion: Is Faith in Our Genes?” by Morton Hunt.  Some highlights:

Religion thus met the newly evolving human need to understand and control life. Religion serves the same purposes as science and the arts – “the extraction of order from the mysteries of the material world,” as Wilson puts it – but in the prescientific era there was no other source of order except for philosophy, which was comprehensible only to a favored few and in any case was nowhere nearly as emotionally satisfying as religion.

Still another major function of religion was to act as a binding and cementing social force. I quote Wilson again: “Religion is … empowered mightily by its principal ally, tribalism. The shamans and priests implore us in somber cadence, Trust in the sacred rituals, become part of the immortal force, you are one of us.” Religious propitiation and sacrifice – near-universals of religious practice – are acts of submission to a dominant being and dominance hierarchy.

For all these reasons, says Wilson, “Acceptance of the supernatural conveyed a great advantage throughout prehistory, when the brain was evolving.” The human mind evolved to believe in the gods even as religious institutions became built-ins of society.

And so, to sum up the sociobiological theory of the roots of religion: genetically built into early human beings was a set of mental, emotional, and social needs that caused culture to develop in certain ways – including the development of various religions – and caused culture, reciprocally, to favor and select for evolution those human traits that provided sociocultural advantages to the individuals possessing them. “Religion,” says Burkert, “follows in the tracks of biology … [and] the aboriginal invention of language … yield[ing] coherence, stability, and control within this world. This is what the individual is groping for, gladly accepting the existence of nonobvious entities or even principles.”

The picture above is a seal unearthed in the 5,000-year-old Mohenjo-daro excavation, showing a human-like form sitting in a yogic pose.

Enhanced by Zemanta

Read Full Post »

The 14th Dalai Lama, a renowned Tibetan Buddhi...
Image via Wikipedia

In this essay, His Holiness the 14th Dalai Lama addresses the question, “What possible benefit could there be for a scientific discipline such as neuroscience in engaging in dialogue with Buddhist contemplative tradition?”

Enhanced by Zemanta

Read Full Post »

Shakti
Image by alicepopkorn via Flickr

Some of the most epic and beautiful of the yoga sutras are found in the final book IV.  One of them popped into mind when I came across a recent neuroscience report entitled, “Predicting Persuasion-Induced Behavior Change from the Brain” by Emily Falk and colleagues at the Department of Psychology at the  University of California, Los Angeles.  [DOI:10.1523/JNEUROSCI.0063-10.2010].  Here, a research team asks if there are places in the brain that encode future – yes, future actions.  More specifically, they asked 20 volunteers to lay in an MRI scanner and listen/view a series of messages on the benefits and importance of sunscreen.  Then, 1-week later, they inquired about the frequency of sunscreen use.  It turns out that sunscreen use did increase (suggesting the subjects read the messages), but more interestingly, that there were correlations in brain activity (in several regions of the brain) with the degree of increased sunscreen use.  That is, some individuals recorded a bit of brain activity that predicted their future use of sunscreen.

Very neat indeed!  although, there are likely many reasons to remain skeptical.  This is because the brain is a very complex system and, with so much going on inside, its likely anyone could find correlations in activity with any-old “something” and “some area of the brain” if they looked hard enough.  In this article however, the authors had preselected their brain regions of interest – the medial frontal cortex and the precuneus – since another group had shown that activity in these regions were able to predict future actions (on the order of a few seconds).  Thus, the research team was not looking for any willy-nilly correlation, but for a specific type of interaction between the brain and future action (this time on the order of weeks).

The particular ancient sutra that may have some poetic tie-ins here is IV.12 atita anagatam svarupatah asti adhvabhedat dharmanam “the existence of the past and future is as real as that of the present.  As moments roll into movements which have yet to appear as the future, the quality of knowledge in one’s intellect and consciousness is affected.”

Might there be neural traces predicting one future actions?  This research makes it seem possible.  Are these traces accessible to ordinary folks or advanced meditators?  Who knows.  As always, the joy lies in trying to find out and trying to reach ever deeper states of harmony and unity.  One thing I found intriguing was that the research team picked the medial prefrontal cortex and the precuneus because these brain regions,

“are reliably co-activated across a host of “self” processes and the extent to which people perceive persuasive messages to be self-relevant has long been thought to play a part in attitude and behavioral change”.

Certainly, when something feels relevant to “me” and reinforces my own “self” image, I’m more prone to remember and act upon it.  Yoga, for example! I hope I’m encoding signals now that will predict my attendance in class this week!

Enhanced by Zemanta

Read Full Post »

Yogi Holy Man, India, c. 1900
Image by whatsthatpicture via Flickr

This post is part of an ongoing exploration of  “mindfulness” biology and the neurobiology of reflecting inwardly on one’s mental life.  I hope it helps support the self-discovery aim of the blog.

In some ways, the 8 limbs of yoga described in the yoga sutras, seem a bit like a ladder, rather than a concentric set of outreached arms or spokes on a wheel.  As I practice this form of postures and mindfulness, it seems like I’m working toward something.  But what?  I certainly feel healthier, and also enjoy the satisfaction of getting slightly more able (ever so slightly) to shift into new postures – so am quite motivated to continue the pursuit.  Perhaps this is how yoga got started eons ago?   Just a pursuit that – by trial and error – left its practitioners feeling more healthy, relaxed and more in touch with their outer and inner worlds?  But where does this path lead, if anywhere?

I was intrigued by a report published in 1973 by an 8-day study carried out on the grounds of the Ravindra Nath Tagore Medical College and Hospital, Udaipur, India and subsequent letter, “The Yogic claim of voluntary control over the heart beat: an unusual demonstration” published in the American Heart Journal, Volume 86 Number 2.  Apparently, a local yogi named Yogi Satyamurti:

Yogi Satyamurti, a sparsely built man of about 60 years of age, remained confined in a small underground pit for 8 days in what according to him was a state of “Samadhi,” or deep meditation, with all bodily activity cut down to the barest minimum.

The medical researchers had the yogi’s heart and other physiological functions under constant watch via electrical recording leads, and watched as the yogi’s heart slowed down (their equipment registered a flatline) a remained so for several days.  Upon opening up the pit, the researchers found:

The Yogi was found sitting in the same posture. One of us immediately went in to examine him. He was in a stuporous condition and was very cold (oral temperature was 34.8O C) [the same temperature as the earth around him].

After a few hours, the yogi had recovered from the experience and displayed normal physiological and behavioral function – despite 8 days underground (air supposedly seeped in from the sides of the pit) with no food or human contact!

An amazing feat indeed – one that has some scientists wondering about the psychology and physiology that occurs when advanced meditators sink into (very deep) states.  John Ding-E Young and Eugene Taylor explored this in an article entitled, “Meditation as a Voluntary Hypometabolic State of Biological Estivation” published in News Physiol. Sci., Volume 13, June 1998.   They  suggest that humans have a kind of latent capacity to enter a kind of dormant or  hibernation-like state that is similar to other mammals and even certain primates.

Meditation, a wakeful hypometabolic state of parasympathetic dominance, is compared with other hypometabolic conditions, such as sleep, hypnosis, and the torpor of hibernation. We conclude that there are many analogies between the physiology of long-term meditators and hibernators across the phylogenetic scale. These analogies further reinforce the idea that plasticity of consciousness remains a key factor in successful biological adaptation.

Practice, practice, practice – towards an ability to engage a latent evolutionary adaptation? Such an adaptation – in humans – sounds hokey, but certainly an interesting idea worth exploring more in the future.

Enhanced by Zemanta

Read Full Post »

Older Posts »