Feeds:
Posts
Comments

Posts Tagged ‘Cognition’

sattestcomic

Don’t worry about your general cognitive ability genes. Otherwise, check out this study led by Drs. Joe Trampush and Anil Malhotra from the Feinstein Institute showing that the less frequent and non-ancestral (A) alelle of rs1906252 was associated with higher Spearman’s General Intelligence (g-factor) scores.  This SNP sits 700 kilobases upstream of a putative ubiquitin ligase subunit (FBXL4) connected to severe psychomotor retardation. Loss-of-function in other ubiquitin ligase subunits have also been implicated in mental retardation.

Read Full Post »

Telomere
Image via Wikipedia

This is a cross post from my other “science & self-exploration” blog about mindfulness and the mind-body connection (yoga).

In 2009, Elizabeth Blackburn received the Nobel Prize in Physiology or Medicine for her work on the biology of so-called telomeres – the DNA sequences found at the end of our chromosomes (actually just a repeating sequence of TTAGGG). The very cool thing about telomeres is that the overall length of these sequences (number of repeating units of TTAGGG) correlates with life-span. This is because as cells in your body are born, they go through a number of cell divisions (each time the cell divides, the telomeres shorten) until they go kaput (replicative senescence). Amazingly, regular cells like these (that normally die after several cell divisions) can be induced to live far longer by simply – lengthening their telomeres (increasing the amount of a telomere lengthening enzyme known as telomerase) – which is why some think of telomeres as the key to cellular immortality.

Imagine your own longevity if all your cells lived twice as long.

With this in mind, it was awesome to read a paper by Dr. Blackburn and colleagues entitled, “Can Meditation Slow Rate of Cellular Aging? Cognitive Stress, Mindfulness, and Telomeres” [doi: 10.1111/j.1749-6632.2009.04414.x]. The authors carefully ponder – but do not definitively assert – a connection between meditative practices and telomere length (and therefore, lifespan). The main thrust of the article is that there are causal links between cellular stress and telomere length AND causal links between physiological stress and meditative practices. Might there, then, be a connection between meditative practices and telomere length?

Above we have reviewed data linking stress arousal and oxidative stress to telomere shortness. Meditative practices appear to improve the endocrine balance toward positive arousal (high DHEA, lower cortisol) and decrease oxidative stress. Thus, meditation practices may promote mitotic cell longevity both through decreasing stress hormones and oxidative stress and increasing hormones that may protect the telomere.

Given that eastern meditative practices are thousands of years old, its strange to say, but these are early days in beginning to understand HOW – in terms of molecular processes – these practices might influence health.

Still, I think I’ll send some thoughts to my telomeres next meditation session!

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Yogi Holy Man, India, c. 1900
Image by whatsthatpicture via Flickr

This post is part of an ongoing exploration of  “mindfulness” biology and the neurobiology of reflecting inwardly on one’s mental life.  I hope it helps support the self-discovery aim of the blog.

In some ways, the 8 limbs of yoga described in the yoga sutras, seem a bit like a ladder, rather than a concentric set of outreached arms or spokes on a wheel.  As I practice this form of postures and mindfulness, it seems like I’m working toward something.  But what?  I certainly feel healthier, and also enjoy the satisfaction of getting slightly more able (ever so slightly) to shift into new postures – so am quite motivated to continue the pursuit.  Perhaps this is how yoga got started eons ago?   Just a pursuit that – by trial and error – left its practitioners feeling more healthy, relaxed and more in touch with their outer and inner worlds?  But where does this path lead, if anywhere?

I was intrigued by a report published in 1973 by an 8-day study carried out on the grounds of the Ravindra Nath Tagore Medical College and Hospital, Udaipur, India and subsequent letter, “The Yogic claim of voluntary control over the heart beat: an unusual demonstration” published in the American Heart Journal, Volume 86 Number 2.  Apparently, a local yogi named Yogi Satyamurti:

Yogi Satyamurti, a sparsely built man of about 60 years of age, remained confined in a small underground pit for 8 days in what according to him was a state of “Samadhi,” or deep meditation, with all bodily activity cut down to the barest minimum.

The medical researchers had the yogi’s heart and other physiological functions under constant watch via electrical recording leads, and watched as the yogi’s heart slowed down (their equipment registered a flatline) a remained so for several days.  Upon opening up the pit, the researchers found:

The Yogi was found sitting in the same posture. One of us immediately went in to examine him. He was in a stuporous condition and was very cold (oral temperature was 34.8O C) [the same temperature as the earth around him].

After a few hours, the yogi had recovered from the experience and displayed normal physiological and behavioral function – despite 8 days underground (air supposedly seeped in from the sides of the pit) with no food or human contact!

An amazing feat indeed – one that has some scientists wondering about the psychology and physiology that occurs when advanced meditators sink into (very deep) states.  John Ding-E Young and Eugene Taylor explored this in an article entitled, “Meditation as a Voluntary Hypometabolic State of Biological Estivation” published in News Physiol. Sci., Volume 13, June 1998.   They  suggest that humans have a kind of latent capacity to enter a kind of dormant or  hibernation-like state that is similar to other mammals and even certain primates.

Meditation, a wakeful hypometabolic state of parasympathetic dominance, is compared with other hypometabolic conditions, such as sleep, hypnosis, and the torpor of hibernation. We conclude that there are many analogies between the physiology of long-term meditators and hibernators across the phylogenetic scale. These analogies further reinforce the idea that plasticity of consciousness remains a key factor in successful biological adaptation.

Practice, practice, practice – towards an ability to engage a latent evolutionary adaptation? Such an adaptation – in humans – sounds hokey, but certainly an interesting idea worth exploring more in the future.

Enhanced by Zemanta

Read Full Post »

03.23.09 [#082] Yogurt Reach
Image by Jeezny via Flickr

Pity the poor brain.  What a job it has!  Did you know that just to reach into a refrigerator and grab a glass of milk, involves at least 50 or so key muscles in the hand, arm and shoulder which can, in principle, lead to over 1,000,000,000,000,000 possible combinations of muscle contractions?  Just so you know, this is 1,000 times MORE contraction possibilities than there are neurons in the brain (only a mere 1,000,000,000,000 neurons).  I’m sorry brain, I’ll keep my hands out of the fridge, I promise!

To accomplish this computational feat, Rodolfo R. Llinas and Sisir Roy in their paper entitled, “The ‘prediction imperative’ as the basis for self-awareness” [doi:10.1098/rstb.2008.0309] suggest that brain has evolved a number of strategies.

For starters, the authors point out that the brain can lower the computational workload of controlling motor output by sending motor control signals in a non-continuous and pulsatile fashion.

“We see that the underlying nature of movement is not smooth and continuous as our voluntary movements overtly appear; rather, the execution of movement is a discontinuous series of muscle twitches, the periodicity of which is highly regular.”

This computational strategy has the added benefit of making it easier to bind and synchronize motor-movement signals with a constant flow of sensory input:

“a periodic control system may allow for input and output to be bound in time; in other words, this type of control system might enhance the ability of sensory inputs and descending motor command/controls to be integrated within the functioning motor apparatus as a whole.“

Another strategy is the use of memory for the purposes of prediction (actually, their paper is part of a special theme issue from the Philosophical Transactions of the Royal Society B entitled, Predictions in the brain: using our past to prepare for the future).  The authors describe the way in which neural circuits in the body and brain are inherently good at learning and storing information which makes them very good at using that information for making predictions and pre-prepared plans for what to do with expected incoming sensory inputs.  These neural mechanisms may also help reduce computational loads associated with moving and coordinating the body.  Interestingly, the authors note,

“while prediction is localized in the CNS, it is a distributed function and does not have a single location within the brain. What is the repository of predictive function? The answer lies in what we call the self, i.e. the self is the centralization of the predictive imperative.  The self is not born out of the realm of consciousness—only the noticing of it is (i.e. self-awareness).”  Here’s a link to Llinas’ book on where the “self” resides.

Lastly, the authors suggest that the genome might encode certain structural and functional aspects of neural development that create a bias for certain types of computation and prime neural networks with a Bayesian type of prior knowledge.  Their idea is akin to an organism being “experience expectant” rather than a pure blank slate that has to learn every stimulus-response contingency by trial-and-error.  To support their notion of the role of the genome, the authors cite a 2003 study from the Yonas Lab on the development of depth perception.  Another related study is covered here.

Methinks that genetic variants might someday be understood in terms of how they bias computational processes.  Something to shoot for in the decades to come!

Enhanced by Zemanta

Read Full Post »

According to wikipedia, “Jean Philippe Arthur Dubuffet (July 31, 1901 – May 12, 1985) was one of the most famous French painters and sculptors of the second half of the 20th century.”  “He coined the term Art Brut (meaning “raw art,” often times referred to as ‘outsider art’) for art produced by non-professionals working outside aesthetic norms, such as art by psychiatric patients, prisoners, and children.”  From this interest, he amassed the Collection de l’Art Brut, a sizable collection of artwork, of which more than half, was painted by artists with schizophrenia.  One such painting that typifies this style is shown here, entitled, General view of the island Neveranger (1911) by Adolf Wolfe, a psychiatric patient.

Obviously, Wolfe was a gifted artist, despite whatever psychiatric diagnosis was suggested at the time.  Nevertheless, clinical psychiatrists might be quick to point out that such work reflects the presence of an underlying thought disorder (loss of abstraction ability, tangentiality, loose associations, derailment, thought blocking, overinclusive thinking, etc., etc.) – despite the undeniable aesthetic beauty in the work.  As an ardent fan of such art,  it made me wonder just how “well ordered” my own thoughts might be.  Given to being rather forgetful and distractable, I suspect my thinking process is just sufficiently well ordered to perform the routine tasks of day-to-day living, but perhaps not a whole lot more so.  Is this bad or good?  Who knows.

However, Krug et al., in their recent paper, “The effect of Neuregulin 1 on neural correlates of episodic memory encoding and retrieval” [doi:10.1016/j.neuroimage.2009.12.062] do note that the brains of unaffected relatives of persons with mental illness show subtle differences in various patterns of activation.  It seems that when individuals are using their brains to encode information for memory storage, unaffected relatives show greater activation in areas of the frontal cortex compared to unrelated subjects.  This so-called encoding process during episodic memory is very important for a healthy memory system and its dysfunction is correlated with thought disorders and other aspects of cognitive dysfunction.  Krug et al., proceed to explore this encoding process further and ask if a well-known schizophrenia risk variant (rs35753505 C vs. T) in the neuregulin-1 gene might underlie this phenomenon.  To do this, they asked 34 TT, 32 TC and 28 CC individuals to perform a memory (of faces) game whilst laying in an MRI scanner.

The team reports that there were indeed differences in brain activity during both the encoding (storage) and retrieval (recall) portions of the task – that were both correlated with genotype – and also in which the CC risk genotype was correlated with more (hyper-) activation.  Some of the brain areas that were hyperactivated during encoding and associated with CC genotype were the left middle frontal gyrus (BA 9), the bilateral fusiform gyrus and the left middle occipital gyrus (BA 19).  The left middle occipital gyrus showed gene associated-hyperactivation during recall.  So it seems, that healthy individuals can carry risk for mental illness and that their brains may actually function slightly differently.

As an ardent fan of Art Brut, I confess I hoped I would carry the CC genotype, but alas, my 23andme profile shows a boring TT genotype.  No wonder my artwork sucks.  More on NRG1 here.

Reblog this post [with Zemanta]

Read Full Post »

wotd044
Image by theloushe via Flickr

** PODCAST accompanies this post**

I have a little boy who loves to run and jump and scream and shout – a lot.  And by this, I mean running – at full speed and smashing his head into my gut,  jumping – off the couch onto my head,  screaming – spontaneous curses and R-rated body parts and bodily functions.  I hope you get the idea.  Is this normal? or (as I oft imagine) will I soon be sitting across the desk from a school psychologist pitching me the merits of an ADHD diagnosis and medication?

Of course, when it comes to behavior, there is not a distinct line one can cross from normal to abnormal.  Human behavior is complex, multi-dimensional and greatly interpreted through the lens of culture.  Our present culture is highly saturated by mass-marketing, making it easy to distort a person’s sense of “what’s normal” and create demand for consumer products that folks don’t really need (eg. psychiatric diagnoses? medications?).   Anyhow, its tough to know what’s normal.  This is an important issue to consider for those (mass-marketing hucksters?) who might be inclined to promote genetic data as “hard evidence” for illness, disorder or abnormality of some sort.

With this in mind, I really enjoyed a recent paper by Stollstorff et al., “Neural response to working memory load varies by dopamine transporter genotype in children” [doi:10.1016/j.neuroimage.2009.12.104] who asked how the brains of healthy children functioned, even though they carry a genotype that has been widely associated with the risk of ADHD.  Healthy children who carry genetic risk for ADHD. Hmm, might this be my boy?

The researchers looked at a 9- vs. 10-repeat VNTR polymorphism in the 3′-UTR of the dopamine transporter gene (DAT1).  This gene – which encodes the very protein that is targeted by so many ADHD medications – influences the re-uptake of dopamine from the synaptic cleft.  In the case of 10/10 genotypes, it seems that DAT1 is more highly expressed, thus leading to more re-uptake and hence less dopamine in the synaptic cleft.  Generally, dopamine is needed to enhance the signal/noise of neurotransmission, so – at the end of the day – the 10/10 genotype is considered less optimal than the 9/9-repeat genotype.  As noted by the researchers, the ADHD literature shows that the 10-repeat allele, not the 9-repeat, is most often associated with ADHD.

The research team asked these healthy children (typically developing children between 7 and 12 years of age) to perform a so-called N-back task which requires that children remember words that are presented to them one-at-a-time.  Each time a new word is presented, the children had to decide whether that word was the same as the previous word (1-back) or the previous, previous word (2-back).  Its a maddening task and places an extreme demand on neural circuits involved in active maintenance of information (frontal cortex) as well as inhibition of irrelevant information that occurs during updating (basal ganglia circuits).

As the DAT1 protein is widely expressed in the basal ganglia, the research team asked where in the brain was variation in the DAT1 (9- vs. 10-repeat) associated with neural activity?  and where was there a further difference between 1-back and 2-back?  Indeed, the team finds that brain activity in many regions of the basal ganglia (caudate, putamen, substantia nigra & subthalamic nucleus) were associated with genetic variation in DAT1.  Neat!  the gene may be exerting an influence on brain function (and behavior) in healthy children, even though they do not carry a diagnosis.  Certainly, genes are not destiny, even though they do influence brain and behavior.

What was cooler to me though, is the way the investigators examined the role of genetic variation in the 1-back (easy or low load condition) vs. 2-back (harder, high-load condition) tasks.  Their data shows that there was less of an effect of genotype on brain activation in the easy tasks.  Rather, only when the task was hard, did it become clear that the basal ganglia in the 10/10 carriers was lacking the necessary brain activation needed to perform the more difficult task.  Thus, the investigators reveal that the genetic risk may not be immediately apparent under conditions where heavy “loads” or demands are not placed on the brain.  Cognitive load matters when interpreting genetic data!

This result made me think that genes in the brain might be a lot like genes in muscles.  Individual differences in muscle strength are not associated with genotype when kids are lifting feathers.  Only when kids are actually training and using their muscles, might one start to see that some genetically advantaged kids have muscles that strengthen faster than others.  Does this mean there is a “weak muscle gene” – yes, perhaps.  But with the proper training regimen, children carrying such a “weak muscle gene” would be able to gain plenty of strength.

I guess its off to the mental and physical gyms for me and my son.

** PODCAST accompanies this post** also, here’s a link to the Vaidya lab!

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »