Feeds:
Posts
Comments

Archive for the ‘5HTT’ Category

rs25532

“I know it now … that I am here to love her. I love her I love her I love her and she doesn’t even have to tell me she loves me back. That’s how much I love her.”

“There there. Just breathe. I wish you would stop obsessing about everything. This week it is Selena Gomez and last week it was Leela from Futurama. You really need to integrate your everyday thoughts and feelings separately from your fantasy life otherwise people are going to ostracize you.”

“I love ostriches so much.”

“Listen. Stop browsing 23andMe data. Just because the “C” allele at rs25532 increases the transcriptional efficiency of the serotonin transporter does not mean that being an LPR “long/long”, rs25532 “C/C” gives you a license to act obsessively. I mean, you’re a TIGER! You don’t even have those alleles.”

“She’s just so beautiful. I want to scratch your eyes out.”

Read Full Post »

Nope.

… from the debunking analysis:

The key comparison here comes from the two extremes: 2 alleles vs. 0. People with 2 alleles are 4 percentage points (more precisely, 3.6 percentage points) more likely to report themselves as very satisfied with their lives. The standard error of this difference in proportions is sqrt(.41*(1-.41)/862+.37*(1-.37)/509) = 0.027, so the difference is not statistically significant at a conventional level.

Enhanced by Zemantamore on this totally over-hyped gene here.

Read Full Post »

Dear Mrs. Jones,

The genetic profiling results show that your son carries 2 copies of the so-called “short” allele at the serotonin transporter linked polymorphic region (5-HTTLPR) and also 2 copies of the T allele of the G-703T polymorphism (rs4570625) in the tryptophan hydroxylase-2 (TPH2) gene.

Some studies find correlations between this genotype and higher amygdala activity – which, in turn – has been correlated with a number of anxiety-related traits and disorders.

In short, you may wish to expect that your son may grow up to be slightly more shy, bashful, diffident, inhibited, reticent, shrinking, hesitant, timid, apprehensive, nervous, wary, demure, coy, blushing, self-effacing, apprehensive, fearful, faint-hearted, wimpish, mousy, lily-livered, weak-kneed, unsure & doubtful.

Congratulations!  He will be a handful to raise as a child but one day make a great scientist, and an even better science blogger.


* thanks fyns for the pic.

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Just a pointer to a great book – The Loss of Sadness: How Psychiatry Transformed Normal Sorrow into Depressive Disorder by Allan V. Horwitz and Jerome C. Wakefield.  Its an in-depth treatment on the many reasons and contexts in which we – quite naturally – feel sad and depressed and the way in which diagnostic criteria can distort the gray area between normal sadness and a psychiatric disorder.  I really enjoyed the developmental perspective on the natural advantages of negative emotions in childhood (a signal to attract caregivers) as well as the detailed evolution of the DSM diagnostic criteria.  The main gist of the book is that much of what psychiatrists treat as emotional disorders are more likely just the natural responses to the normal ups and downs of life – not disorders at all.  A case for American consumers as pill-popping suckers to medical-pharma-marketing overreach (here’s a related post on this overreach notion pointing to the work of David Healy).

Reading the book makes me feel liberated from the medical labels that are all too readily slapped on healthy people.  There is much that is healthy about sadness and many reasons and contexts in which its quite natural.  From now on, instead of trying to escape from, or rid myself of sadness, I will embrace it and let myself feel it and work through it.  Who knows, maybe this is a good first step in a healthy coping process.

If depressed emotional states are more a part of the normal range of emotions (rather than separate disordered states) then does this allow us to make predictions about the underlying genetic bases for these states?    Perhaps not.   However, on page 172, the authors apply their critical view to the highly cited Caspi et al., article (showing that 5HTT genotype interacts with life stress in the presentation of depressive illness – critiqued here).  They note that the incidence of depression at 17% in the sample is much too high – most certainly capturing a lot of normal sadness.  Hence, the prevalent short allele in the 5HTT promoter might be better thought of as a factor that underlies how healthy people respond to social stress – rather than as a drug target or risk factor for psychiatric illness.

Reblog this post [with Zemanta]

Read Full Post »

Brainstorm
Image by jurvetson via Flickr

pointer to: Computational Models of Basal Ganglia Function where Kenji Doya provides computational explanations for neuromodulators and their role in reinforcement learning. In his words, “Dopamine encodes the temporal difference error — the reward learning signal. Acetylcholine affects learning rate through memory updates of actions and rewards. Noradrenaline controls width or randomness of exploration. Serotonin is implicated in “temporal discounting,” evaluating if a given action is worth the expected reward.”

This type of amazing research provides a pathway to better understand how genes contribute to how the brain “works” as a 3-dimensional biochemical computational machine.

Reblog this post [with Zemanta]

Read Full Post »

Human Genome
Image by Dollar Bin via Flickr

pointer to: download Power Point presentation hosted on the HUGO website entitled, “From the human genome to human behaviour: how far have we travelled?” (both English and Russian text) – by Ian Craig and Nick Yankovsky, Education Council Human Genome Organisation.

Covers recent findings on MAOA and 5HTT several and others also covered here.

Congrats to Hsien on the new position!

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »