Feeds:
Posts
Comments

Archive for the ‘5HTT’ Category

rs25532

“I know it now … that I am here to love her. I love her I love her I love her and she doesn’t even have to tell me she loves me back. That’s how much I love her.”

“There there. Just breathe. I wish you would stop obsessing about everything. This week it is Selena Gomez and last week it was Leela from Futurama. You really need to integrate your everyday thoughts and feelings separately from your fantasy life otherwise people are going to ostracize you.”

“I love ostriches so much.”

“Listen. Stop browsing 23andMe data. Just because the “C” allele at rs25532 increases the transcriptional efficiency of the serotonin transporter does not mean that being an LPR “long/long”, rs25532 “C/C” gives you a license to act obsessively. I mean, you’re a TIGER! You don’t even have those alleles.”

“She’s just so beautiful. I want to scratch your eyes out.”

Read Full Post »

Nope.

… from the debunking analysis:

The key comparison here comes from the two extremes: 2 alleles vs. 0. People with 2 alleles are 4 percentage points (more precisely, 3.6 percentage points) more likely to report themselves as very satisfied with their lives. The standard error of this difference in proportions is sqrt(.41*(1-.41)/862+.37*(1-.37)/509) = 0.027, so the difference is not statistically significant at a conventional level.

Enhanced by Zemantamore on this totally over-hyped gene here.

Read Full Post »

Dear Mrs. Jones,

The genetic profiling results show that your son carries 2 copies of the so-called “short” allele at the serotonin transporter linked polymorphic region (5-HTTLPR) and also 2 copies of the T allele of the G-703T polymorphism (rs4570625) in the tryptophan hydroxylase-2 (TPH2) gene.

Some studies find correlations between this genotype and higher amygdala activity – which, in turn – has been correlated with a number of anxiety-related traits and disorders.

In short, you may wish to expect that your son may grow up to be slightly more shy, bashful, diffident, inhibited, reticent, shrinking, hesitant, timid, apprehensive, nervous, wary, demure, coy, blushing, self-effacing, apprehensive, fearful, faint-hearted, wimpish, mousy, lily-livered, weak-kneed, unsure & doubtful.

Congratulations!  He will be a handful to raise as a child but one day make a great scientist, and an even better science blogger.


* thanks fyns for the pic.

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Just a pointer to a great book – The Loss of Sadness: How Psychiatry Transformed Normal Sorrow into Depressive Disorder by Allan V. Horwitz and Jerome C. Wakefield.  Its an in-depth treatment on the many reasons and contexts in which we – quite naturally – feel sad and depressed and the way in which diagnostic criteria can distort the gray area between normal sadness and a psychiatric disorder.  I really enjoyed the developmental perspective on the natural advantages of negative emotions in childhood (a signal to attract caregivers) as well as the detailed evolution of the DSM diagnostic criteria.  The main gist of the book is that much of what psychiatrists treat as emotional disorders are more likely just the natural responses to the normal ups and downs of life – not disorders at all.  A case for American consumers as pill-popping suckers to medical-pharma-marketing overreach (here’s a related post on this overreach notion pointing to the work of David Healy).

Reading the book makes me feel liberated from the medical labels that are all too readily slapped on healthy people.  There is much that is healthy about sadness and many reasons and contexts in which its quite natural.  From now on, instead of trying to escape from, or rid myself of sadness, I will embrace it and let myself feel it and work through it.  Who knows, maybe this is a good first step in a healthy coping process.

If depressed emotional states are more a part of the normal range of emotions (rather than separate disordered states) then does this allow us to make predictions about the underlying genetic bases for these states?    Perhaps not.   However, on page 172, the authors apply their critical view to the highly cited Caspi et al., article (showing that 5HTT genotype interacts with life stress in the presentation of depressive illness – critiqued here).  They note that the incidence of depression at 17% in the sample is much too high – most certainly capturing a lot of normal sadness.  Hence, the prevalent short allele in the 5HTT promoter might be better thought of as a factor that underlies how healthy people respond to social stress – rather than as a drug target or risk factor for psychiatric illness.

Reblog this post [with Zemanta]

Read Full Post »

Brainstorm
Image by jurvetson via Flickr

pointer to: Computational Models of Basal Ganglia Function where Kenji Doya provides computational explanations for neuromodulators and their role in reinforcement learning. In his words, “Dopamine encodes the temporal difference error — the reward learning signal. Acetylcholine affects learning rate through memory updates of actions and rewards. Noradrenaline controls width or randomness of exploration. Serotonin is implicated in “temporal discounting,” evaluating if a given action is worth the expected reward.”

This type of amazing research provides a pathway to better understand how genes contribute to how the brain “works” as a 3-dimensional biochemical computational machine.

Reblog this post [with Zemanta]

Read Full Post »

Human Genome
Image by Dollar Bin via Flickr

pointer to: download Power Point presentation hosted on the HUGO website entitled, “From the human genome to human behaviour: how far have we travelled?” (both English and Russian text) – by Ian Craig and Nick Yankovsky, Education Council Human Genome Organisation.

Covers recent findings on MAOA and 5HTT several and others also covered here.

Congrats to Hsien on the new position!

Reblog this post [with Zemanta]

Read Full Post »

labyrinthine circuit board lines
Image by quapan via Flickr

Amidst a steady flow of upbeat research news in the behavioral-genetics literature, there are many inconvenient, uncomfortable, party-pooping sentiments that are more often left unspoken.  I mean, its a big jump – from gene to behavior – and just too easy to spoil the mood by reminding your colleagues that, “well, everything is connected to everything” or “that gene association holds only for that particular task“.  Such may have been the case often times in the past decade when the so-called imaging-genetics literature emerged to parse out a role for genetic variation in the structure and functional activation of the brain using various neuroimaging methods.  Sure, the 5HTT-LPR was associated with amygdala activation during a face matching task, but what about other tasks (and imaging modalities) and other brain regions that express this gene.  How could anyone (let alone NIMH) make sense out of all of those – not to mention the hundreds of other candidate genes poised for imaging-genetic research?

With this in mind, it is a pleasure to meet the spoiler-of-spoilers! Here is a research article that examines a few candidate genetic polymorphisms and compares their findings across multiple imaging modalities.  In his article, “Neural Connectivity as an Intermediate Phenotype: Brain Networks Under Genetic Control” [doi: 10.1002/hbm.20639] Andreas Meyer-Lindenberg examines the DARPP32, 5HTT and MAOA genes and asks whether their associations with aspects of brain structure/function are in any way consistent across different neuroimaging modalities.  Amazingly, the answer seems to be, yes.

For example, he finds that the DARPP32 associations are consistently associated with the striatum and prefrontal-striatal connectivity – even as the data were collected using voxel-based morphometry, fMRI in separate tasks, and an analysis of functional connectivity.  Similarly, both the 5HTT and MAOA gene promoter repeats also showed consistent findings within a medial prefrontal and amygdala circuit across these various modalities.

This type of finding – if it holds up to the spoilers & party poopers – could radically simplify the understanding of how genes influence cognitive function and behavior.  As suggested by Meyer-Lindenberg, “features of connectivity often better account for behavioral effects of genetic variation than regional parameters of activation or structure.”  He suggests that dynamic causal modeling of resting state brain function may be a powerful approach to understand the role of a gene in a rather global, brain-wide sort of way.  I hope so and will be following this cross-cutting “connectivity” approach in much more detail!

Reblog this post [with Zemanta]

Read Full Post »

Human chromosome 15
Image via Wikipedia

One way to organize the great and growing body of research into autism is via a sort-of  ‘top-down’ vs. ‘bottom-up’ perspective.  From the ‘top-down’ one can read observational research that carefully catalogs the many & varied social and cognitive attributes that are associated with autism.  Often times, these behavioral studies are coupled with neurochemical or neuroimaging studies that test whether variation in such biomarkers is correlated with aspects of autism.  In this manner, the research aims to dig down into the physiology and biochemistry of the developing brain to find out what is different and what differences might predict the onset of autistic traits.  At the deepest biological level – the bedrock, so to speak – are a number of genetic variations that have been correlated with autism.  These genetic variants permit another research strategy – a ‘bottom-up’ strategy that allows investigators to ask, “what goes wrong when we manipulate this genetic variant?”  While proponents of each strategy are painfully aware of the limitations of their own strategy – oft on the barbed-end of commentary from the other side – it is especially exciting when the ‘top-down’ and ‘bottom-up’ methods find themselves meeting in the agreement in the middle.

So is the case with Nakatani et al., “Abnormal Behavior in a Chromosome- Engineered Mouse Model for Human 15q11-13 Duplication Seen in Autism” [doi: 10.1016/j.cell.2009.04.024] who created a mouse that carries a 6.3 megabase duplication of a region in the mouse that luckily happens to be remarkably conserved in terms of gene identity and order with the 15q11-13 region in humans – a region that, when duplicated, is found in about 5% of cases with autism.  [click here for maps of mouse human synteny/homology on human chr15] Thus the team was able to engineer mice with the duplication and ask, “what goes wrong?” and “does it resemble autism in any kind of meaningful way (afterall these are mice we’re dealing with)?”

Well, the results are rather astounding to me.  Most amazing is the expression of a small nucleoar RNA (snoRNA) – SNORD115 (mouse-HBII52) – that function in the nucleolus of the cell, and plays a role in the alternative splicing of exon Vb of the 5HT2C receptor.  The team then found that the editing of 5HTR2C was altered in the duplication mice and also that Ca++ signalling was increased when the 5HTR2C receptors were stimulated in the duplication mice (compared to controls).  Thus, a role for altered serotonin function – which has been a longstanding finding in the ‘topdown’ approach – was met midway and affirmed by this ‘bottom-up’ approach!  Also included in the paper are descriptions of the abberant social behaviors of the mice via a 3-chambered social interaction test where duplication mice were rather indifferent to a stranger mouse (wild-type mice often will hang out with each other).

Amazing stuff!

Another twist to the story is the way in which the 15q11-13 region displays a phenomenon known as genomic-imprinting, whereby only the mother or the father’s portion of the chromosome is expressed.  For example, the authors show that the mouse duplication is ‘maternally imprinted’ meaning that that pups do not express the copy of the duplication that comes from the mother (its expression is shut down via epigenetic mechanisms that involve – wait for it – snoRNAs!)  so the effects that they report are only from mice who obtained the duplication from their fathers.  So, if you by chance were wondering why its so tough to sort out the genetic basis of autism – here’s one reason why.  On top of this, the 5HTR2C gene is located on the X-chromosome which complicates the story even more in terms of sorting out the inheritance of the disorder.

Further weird & wild is the fact that the UBE3A gene (paternally imprinted) and the genetic cause of Angelman Syndrome sits in this region – as does the SNRPN gene (maternally imprinted) which encodes a protein that influences alternative RNA splicing and also gives rise to Prader-Willi syndrome.  Thus, this tiny region of the genome, which carries so-called “small” RNAs can influence a multitude of developmental disabilities.  Certainly, a region of the genome that merits further study!!

Reblog this post [with Zemanta]

Read Full Post »

Cingulum (anatomy)
Image via Wikipedia

One of the most well-studied genetic polymorphisms in the behavioral- psychiatric- cognitive-genetics area is the 5HTT-LPR, a short repeating sequence that mediates the transcriptional efficiency of the serotonin transporter.  Given the wide-ranging effects of 5HTT on the developing and mature nervous system, it is perhaps not surprising that variation in 5HTT levels can have wide-ranging effects on brain structure, function and behavior (see here and here for 2 of my own posts on this).  One of the latest findings has to do with the issue of  “functional connectivity” or the degree to which 2 separate brain regions co-activate and interact with each other – this type of functional interaction and integration of brain systems being a good thing.

Earlier studies have shown that individuals who carry the “short” allele at the 5HTT-LPR show less coupling of their frontal cortex (perigenual anterior cingulate cortex) with their amygdala – which perhaps indicates that their frontal cortex has a harder time regulating the amygdala.  This may be a mechanistic explanation for why such people have been found to be more prone to anxiety.  A new study by Pachecco et al., seems to support this mechanistic account –  however, they confirm the coupling model using a different neuroimaging modality – which makes the paper especially interesting.  In their article, “Frontal-Limbic White Matter Pathway Associations with the Serotonin Transporter Gene Promoter Region (5-HTTLPR) Polymorphism” [doi: 10.1523/JNEUROSCI.0896-09.2009] use a method known as diffusion tensor imaging, a modality that is particularly sensitive to white matter tracts that are known to function as high-speed interlinks between disparate areas of the brain.  They find that a particular tract – the left frontal uncinate fasciculus – is differentially formed, and is less so, in carriers of the short allele.  The authors suggest that the association of the 5HTT-LPR with functional connectivity may be somewhat due to the white matter tracts that connect separate brain regions.  Interestingly, the finding was not seen in other white matter tracts (fasciculi) – which suggests that the genetic polymorphism is interacting with other – yet to be identified – factors (environment perhaps?) that lead to such a specific difference.

Reblog this post [with Zemanta]

Read Full Post »

Mike Defensor at a political rally in Cebu City
Image via Wikipedia

Shopaholics and political activists might want to take a look at Jonathan Roiser et al.‘s paper, “A Genetically Mediated Bias in Decision Making Driven by Failure of Amygdala Control” [doi:] as an early example of the nexus of “behavioral-neuro-economic-genetics” or “neuro-genetic-marketing” or “neuro-eco-geno” as it might (not) be called one day.  In any case, it has long been known that humans are susceptible to the “framing effect” – that is – we favor certainty over risk when we stand to gain ($10 now vs. 20% chance of winning $50) and rather favor risk over certainty when we stand to lose (20% chance of losing $50 vs. lose $10 now).  Political and retailing experts have long-since exploited these tendencies in voters/consumers (unemployment is on the rise – lets take a chance on this new policy! or this yogurt is 99% fat free! vs. its got 1% of unhealthy fat).

Roiser and team evaluate the extent to which individuals who are homozygous at the 5HTT-LPR “short” allele differ from “long(a)” allele homozygotes when confronted with win/lose, sure-thing/gamble contingencies.  Interestingly, while both groups demonstrated the tendency to avoid risk when they stood to gain money and preferred to gamble when they stood to lose money, the group that was homozygous at the 5HTT-LPR was almost twice as likely to do so – thus identifying a group that is significantly more susceptible to the framing of choices (they otherwise did not differ from the “long(a)” group in control trials or in other aspects of overall performance).

Analysis of brain activity shows a now well-replicated association of “short”-allele genotypes with increased amygdala activity  – in this case the association was observed when participants were confronted with the choice of “pick the sure thing” vs. “gamble” in both the gain and loss conditions.  Also, the group reports on the functional coupling of the amygdala and cingulate cortex – an effect which has been previously associated with variation at the 5HTT-LPR – and shows that individuals who did not show functional coupling between these brain regions were more susceptible to the framing effect.  Hence, the “short” allele group may have a harder time bringing cortical control to their immediate emotional responses.

What might these findings tell us about decision making in humans?  Well, as pointed out by the authors, the findings in the amygdala and cingulate cortex suggest that the emotional systems of the participants are engaged as well as genetic factors, such as 5HTT that are known to regulate the early development and responsivity of these emotional systems.

Most of us already know that we don’t make decisions only using our minds – and doncha know – retailers and political pollsters are already experts at gaming our innate propensities.  Some, it seems, perhaps more than others.

Reblog this post [with Zemanta]

Read Full Post »

Flash circuit

Image by cibomahto via Flickr

A recent paper from Andreas Heinz and colleagues (doi: 10.1038/nn2222) provides more neuroimaging evidence in humans for a a circuit that regulates our responsivity to stimuli that evoke emotional responses.  The basic circuitry involves the amygdala (a place in the brain where emotional memories are registered), the prefrontal cortex (a part of the brain that is involved in making decisions and assessing threats) and the cingulate cortex (a place in the brain where expectations are compared to sensory inputs & outgoing responses).  These 3 brain regions are interconnected in a loop through various synaptic contacts and the responsivity of these synapses can be modulated by neuomodulators such as dopamine, serotonin and noradrenaline.  It turns out, that several neuroimaging studies have begun to demonstrate that this (relatively) simple circuitry underlies human personality and temperament. In the Heinz study, the level of dopamine that was released into the amygdala was correlated with levels of functional activation to emotional stimuli as well as a dimension of temperament known as negative affect.

I recall once having taken the Meyers-Briggs assessment in graduate school and had a blast comparing my results with my wife – who was almost my polar opposite. Now, the latest neuroimaging and imaging-genetic research has begun to explain the complexities of human personality in basic neural circuitry where genes such as 5HTT and MAOA ‘turn up’ or turn down’ the gain on various synaptic contacts in this circuit – leading to the immense, yet systematic variation in personality and temperament that makes our social lives so interesting.  As I navigate my way through marriage and parenthood, I’m often glad I took the personality test with my wife many years ago.  It always helps to see things from the other person’s perspective.  Now, as she obtains her 23andMe profile, perhaps we will begin to compare our genomes together – the ultimate form of marriage counseling !!  Click here for more personality tests.

Reblog this post [with Zemanta]

Read Full Post »

Lysergic acid diethylamideImage via Wikipedia Without a doubt, one of the low points of any marriage comes when you have to select a new paint colors. To avoid unnecessary strain, I usually just go along to get along, but Mother Nature allows no easy escape from this inevitable moment in our life cycle. After a third trip to the paint store, I found myself literally, up the wall, painting another test patch in a dark upper corner. Whilst brushing away, I was reminded of a lecture by V. S. Ramachandran who happened upon a colorblind subject who reported subtle differences in the colors of certain digits. In their article, “We also observed one case in which we believe cross activation enables a colorblind synesthete to see numbers tinged with hues he otherwise cannot perceive; charmingly, he refers to these as “Martian colors.” Although his retinal color receptors cannot process certain wavelengths, we suggest that his brain color area is working just fine and being cross-activated when he sees numbers.“Jay Gingrich and colleagues report (DOI) that the serotonin 2A receptors mediate the “synesthesia-like” effects of psychoactive hallucinogens such as LSD specifically via pertussis toxin-sensitive heterotrimeric G(i/o) proteins and src. Now, I’m a fan of genetic conflict hypotheses of all sorts, and perfectly willing to acknowledge that Mother Nature has stacked the deck against my Y-chromosome in many ways, but as my wife complained, yet again, that the new color was not, “the color in her head”, I began to wonder about natural mechanisms of synesthesia and the natural history of HTR2A and Mother Nature’s often dark sense of humor.

Reblog this post [with Zemanta]

Read Full Post »

Oil on canvasImage via Wikipedia The recent paper, “Genetic Markers of Suicidal Ideation Emerging During Citalopram Treatment of Major Depression” finds that among 68 candidate genes, markers for 2 AMPA-type glutamate receptors (rs4825476, rs2518224: GRIA3 and GRIK2) show significant association in 120 individuals who experienced suicidal ideation in a large medication trial for major depressive disorder. Many families with loved ones suffering from depression remain wary and confused about a possible causal relationship between selective serotonin reuptake inhibitor (SSRI) antidepressants and suicide. A current FDA-mandated black box warning advises youths on the potential risks. This recent genetic study seems to provide a meaningful step forward in better understanding the mechanism of shifts in mood and cognition that occur in some individuals. But like many brain research studies though, shining a tiny ray of light on a puzzle suddenly illuminates massive complexities, previously unseen. A great deal of research shows that SSRI exposure leads to long lasting changes in AMPA receptor expression, localization and function, – but it’s unclear where a specific link between this and changes in mood and cognition will be drawn.

Reblog this post [with Zemanta]

Read Full Post »