Feeds:
Posts
Comments

Posts Tagged ‘Frontal lobe’

You mean these types of executives?  No … well, sort of, maybe.  Some people can control their thoughts and actions better than others.

Individuals vary widely in their abilities to control their own thoughts and actions. Some people seem ruled by impulses, while others manage successfully to regulate their behaviors. From the perspective of cognitive psychology, such variation reflects individual differences in executive functions, a collection of correlated but separable control processes that regulate lower-level cognitive processes to shape complex performance.

Results indicated that executive functions are correlated because they are influenced by a highly heritable (99%) common factor that goes beyond general intelligence or perceptual speed, and they are separable because of additional genetic influences unique to particular executive functions. This combination of general and specific genetic influences places executive functions among the most heritable psychological traits.

Read Full Post »

… but you knew that already.  Here’s an example of how a phenomenon known as exon shufflin’ can lead to evolutionary diversity (here involving SNAP25‘s exon 5a variant for early brain development while the exon 5b variant is used later in development) .  Perhaps we owe our awesome, ahem, “higher” cognitive abilities to this ancient exon duplication … video below notwithstanding.

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Where's Waldo in Google Maps?
Image by Si1very via Flickr

In an earlier post on Williams Syndrome, we delved into the notion that sometimes a genetic variant can lead to enhanced function – such as certain social behaviors in the case of WS.  A mechanism that is thought to underlie this phenomenon has to do with the way in which information processing in the brain is widely distributed and that sometimes a gene variant can impact one processing pathway, while leaving another pathway intact, or even upregulated.  In the case of Williams Syndrome a relatively intact ventral stream (“what”) processing but disrupted dorsal stream (“where”) processing leads to weaker projections to the frontal cortex and amygdala which may facilitate gregarious and prosocial (a lack of fear and inhibition) behavior.  Other developmental disabilities may differentially disrupt these 2 visual information processing pathways.  For instance, developmental dyspraxia contrasts with WS as it differentially disrupts the ventral stream processing pathway.

A recent paper by Woodcock and colleagues in their article, “Dorsal and ventral stream mediated visual processing in genetic subtypes of Prader–Willi syndrome” [doi:10.1016/j.neuropsychologia.2008.09.019] ask how another developmental disability – Prader-Willi syndrome – might differentially influence the development of these information processing pathways.  PWS arises from the lack of expression (via deletion or uniparental disomy) of a cluster of paternally expressed genes in the 15q11-13 region (normally the gene on the maternally inherited chromosome is silent, or imprinted – related post here).  By comparing PWS children to matched controls, the team reports evidence showing that PWS children who carry the deletion are slightly more impaired in a task that depends on the dorsal “where” pathway whilst some sparing or relative strength in the ventral “what” pathway.

Reblog this post [with Zemanta]

Read Full Post »

An historic find has occurred in the quest (gold-rush, if you will) to link genome variation with brain structure-function variation.  This is the publication of the very first genome-wide (GWAS) analysis of individual voxels (voxels are akin to pixels in a photograph, but are rather 3D cubes of brain-image-space about 1mm on each side) of brain structure – Voxelwise genome-wide association study (vGWAS) [doi: 10.1016/j.neuroimage.2010.02.032] by Jason Stein and colleagues under the leadership of Paul M. Thompson, a  leader in the area of neuroimaging and genetics – well-known for his work on brain structure in twin and psychiatric patient populations.

In an effort to discover genes that contribute to individual differences in brain structure, the authors took on the task of statistically analyzing the some 31,622 voxels (per brain) obtained from high-resolution structural brain scans; with 448,293 Illumina SNP genotypes (per person) with minor allele frequencies greater than 0.1 (common variants); in 740 unrelated healthy caucasian adults.  When performed on a voxel-by-voxel basis, this amounts to some 14 billion statistical tests.

Yikes!  A statistical nightmare with plenty of room for false positive results, not to mention the recent disillusionment with the common-variant GWAS approach?  Certainly.  The authors describe these pitfalls and other scenarios wherein false data is likely to arise and most of the paper addresses the pros and cons of different statistical analysis strategies – some which are prohibitive in their computational demands.  Undaunted, the authors describe several approaches for establishing appropriate thresholds and then utilize a ‘winner take all’ analysis strategy wherein a single ‘most-associated winning snp’ is identified for each voxel, which when clustered together in hot spots (at P = 2 x 10e-10), can point to specific brain areas of interest.

Using this analytical approach, the authors report that 8,212 snps were identified as ‘winning, most-associated’ snps across the 31,622 voxels.  They note that there was not as much symmetry with respect to winning snps in the left hemispere and corresponding areas in the right hemisphere, as one might have expected.  The 2 most significant snps across the entire brain and genome were rs2132683 and rs713155 which were associated with white matter near the left posterior lateral ventricle.  Other notable findings were rs2429582 in the synaptic (and possible autism risk factor) CADPS2 gene which was associated with temporal lobe structure and rs9990343 which sits in an intergenic region but is associated with frontal lobe structure.  These and several other notable snps are reported and brain maps are provided that show where in the brain each snp is associated.

As in most genome-wide studies, one can imagine that the authors were initially bewildered by their unexpected findings.  None of the ‘usual suspects’ such as neurotransmitter receptors, transcription factors, etc. etc. that dominate the psychiatric genetics literature.  Bewildered, perhaps, but maybe thats part of the fun and excitement of discovery!  Very exciting stuff to come I’ll bet as this new era unfolds!

Reblog this post [with Zemanta]

Read Full Post »

According to wikipedia, “Jean Philippe Arthur Dubuffet (July 31, 1901 – May 12, 1985) was one of the most famous French painters and sculptors of the second half of the 20th century.”  “He coined the term Art Brut (meaning “raw art,” often times referred to as ‘outsider art’) for art produced by non-professionals working outside aesthetic norms, such as art by psychiatric patients, prisoners, and children.”  From this interest, he amassed the Collection de l’Art Brut, a sizable collection of artwork, of which more than half, was painted by artists with schizophrenia.  One such painting that typifies this style is shown here, entitled, General view of the island Neveranger (1911) by Adolf Wolfe, a psychiatric patient.

Obviously, Wolfe was a gifted artist, despite whatever psychiatric diagnosis was suggested at the time.  Nevertheless, clinical psychiatrists might be quick to point out that such work reflects the presence of an underlying thought disorder (loss of abstraction ability, tangentiality, loose associations, derailment, thought blocking, overinclusive thinking, etc., etc.) – despite the undeniable aesthetic beauty in the work.  As an ardent fan of such art,  it made me wonder just how “well ordered” my own thoughts might be.  Given to being rather forgetful and distractable, I suspect my thinking process is just sufficiently well ordered to perform the routine tasks of day-to-day living, but perhaps not a whole lot more so.  Is this bad or good?  Who knows.

However, Krug et al., in their recent paper, “The effect of Neuregulin 1 on neural correlates of episodic memory encoding and retrieval” [doi:10.1016/j.neuroimage.2009.12.062] do note that the brains of unaffected relatives of persons with mental illness show subtle differences in various patterns of activation.  It seems that when individuals are using their brains to encode information for memory storage, unaffected relatives show greater activation in areas of the frontal cortex compared to unrelated subjects.  This so-called encoding process during episodic memory is very important for a healthy memory system and its dysfunction is correlated with thought disorders and other aspects of cognitive dysfunction.  Krug et al., proceed to explore this encoding process further and ask if a well-known schizophrenia risk variant (rs35753505 C vs. T) in the neuregulin-1 gene might underlie this phenomenon.  To do this, they asked 34 TT, 32 TC and 28 CC individuals to perform a memory (of faces) game whilst laying in an MRI scanner.

The team reports that there were indeed differences in brain activity during both the encoding (storage) and retrieval (recall) portions of the task – that were both correlated with genotype – and also in which the CC risk genotype was correlated with more (hyper-) activation.  Some of the brain areas that were hyperactivated during encoding and associated with CC genotype were the left middle frontal gyrus (BA 9), the bilateral fusiform gyrus and the left middle occipital gyrus (BA 19).  The left middle occipital gyrus showed gene associated-hyperactivation during recall.  So it seems, that healthy individuals can carry risk for mental illness and that their brains may actually function slightly differently.

As an ardent fan of Art Brut, I confess I hoped I would carry the CC genotype, but alas, my 23andme profile shows a boring TT genotype.  No wonder my artwork sucks.  More on NRG1 here.

Reblog this post [with Zemanta]

Read Full Post »

wotd044
Image by theloushe via Flickr

** PODCAST accompanies this post**

I have a little boy who loves to run and jump and scream and shout – a lot.  And by this, I mean running – at full speed and smashing his head into my gut,  jumping – off the couch onto my head,  screaming – spontaneous curses and R-rated body parts and bodily functions.  I hope you get the idea.  Is this normal? or (as I oft imagine) will I soon be sitting across the desk from a school psychologist pitching me the merits of an ADHD diagnosis and medication?

Of course, when it comes to behavior, there is not a distinct line one can cross from normal to abnormal.  Human behavior is complex, multi-dimensional and greatly interpreted through the lens of culture.  Our present culture is highly saturated by mass-marketing, making it easy to distort a person’s sense of “what’s normal” and create demand for consumer products that folks don’t really need (eg. psychiatric diagnoses? medications?).   Anyhow, its tough to know what’s normal.  This is an important issue to consider for those (mass-marketing hucksters?) who might be inclined to promote genetic data as “hard evidence” for illness, disorder or abnormality of some sort.

With this in mind, I really enjoyed a recent paper by Stollstorff et al., “Neural response to working memory load varies by dopamine transporter genotype in children” [doi:10.1016/j.neuroimage.2009.12.104] who asked how the brains of healthy children functioned, even though they carry a genotype that has been widely associated with the risk of ADHD.  Healthy children who carry genetic risk for ADHD. Hmm, might this be my boy?

The researchers looked at a 9- vs. 10-repeat VNTR polymorphism in the 3′-UTR of the dopamine transporter gene (DAT1).  This gene – which encodes the very protein that is targeted by so many ADHD medications – influences the re-uptake of dopamine from the synaptic cleft.  In the case of 10/10 genotypes, it seems that DAT1 is more highly expressed, thus leading to more re-uptake and hence less dopamine in the synaptic cleft.  Generally, dopamine is needed to enhance the signal/noise of neurotransmission, so – at the end of the day – the 10/10 genotype is considered less optimal than the 9/9-repeat genotype.  As noted by the researchers, the ADHD literature shows that the 10-repeat allele, not the 9-repeat, is most often associated with ADHD.

The research team asked these healthy children (typically developing children between 7 and 12 years of age) to perform a so-called N-back task which requires that children remember words that are presented to them one-at-a-time.  Each time a new word is presented, the children had to decide whether that word was the same as the previous word (1-back) or the previous, previous word (2-back).  Its a maddening task and places an extreme demand on neural circuits involved in active maintenance of information (frontal cortex) as well as inhibition of irrelevant information that occurs during updating (basal ganglia circuits).

As the DAT1 protein is widely expressed in the basal ganglia, the research team asked where in the brain was variation in the DAT1 (9- vs. 10-repeat) associated with neural activity?  and where was there a further difference between 1-back and 2-back?  Indeed, the team finds that brain activity in many regions of the basal ganglia (caudate, putamen, substantia nigra & subthalamic nucleus) were associated with genetic variation in DAT1.  Neat!  the gene may be exerting an influence on brain function (and behavior) in healthy children, even though they do not carry a diagnosis.  Certainly, genes are not destiny, even though they do influence brain and behavior.

What was cooler to me though, is the way the investigators examined the role of genetic variation in the 1-back (easy or low load condition) vs. 2-back (harder, high-load condition) tasks.  Their data shows that there was less of an effect of genotype on brain activation in the easy tasks.  Rather, only when the task was hard, did it become clear that the basal ganglia in the 10/10 carriers was lacking the necessary brain activation needed to perform the more difficult task.  Thus, the investigators reveal that the genetic risk may not be immediately apparent under conditions where heavy “loads” or demands are not placed on the brain.  Cognitive load matters when interpreting genetic data!

This result made me think that genes in the brain might be a lot like genes in muscles.  Individual differences in muscle strength are not associated with genotype when kids are lifting feathers.  Only when kids are actually training and using their muscles, might one start to see that some genetically advantaged kids have muscles that strengthen faster than others.  Does this mean there is a “weak muscle gene” – yes, perhaps.  But with the proper training regimen, children carrying such a “weak muscle gene” would be able to gain plenty of strength.

I guess its off to the mental and physical gyms for me and my son.

** PODCAST accompanies this post** also, here’s a link to the Vaidya lab!

Reblog this post [with Zemanta]

Read Full Post »

Recreated :File:Neuron-no labels2.png in Inksc...
Image via Wikipedia

The A-to-T SNP rs7794745 in the CNTNAP2 gene was found to be associated with increased risk of autism (see Arking et al., 2008).  Specifically, the TT genotype, found in about 15% of individuals, increases these folks’ risk by about 1.2-1.7-fold.  Sure enough, when I checked my 23andMe profile, I found that I’m one of these TT risk-bearing individuals.  Interesting, although not alarming since me and my kids are beyond the age where one typically worries about autism.  Still, one can wonder if such a risk factor might have exerted some influence on the development of my brain?

The recent paper by Tan et al., “Normal variation in fronto-occipital circuitry and cerebellar structure with an autism-associated polymorphism of CNTNAP2” [doi:10.1016/j.neuroimage.2010.02.018 ] suggests there may be subtle, but still profound influences of the TT genotype on brain development in healthy individuals.  According to the authors, “homozygotes for the risk allele showed significant reductions in grey and white matter volume and fractional anisotropy in several regions that have already been implicated in ASD, including the cerebellum, fusiform gyrus, occipital and frontal cortices. Male homozygotes for the risk alleles showed greater reductions in grey matter in the right frontal pole and in FA in the right rostral fronto-occipital fasciculus compared to their female counterparts who showed greater reductions in FA of the anterior thalamic radiation.”

The FA (fractional anisotropy – a measurement of white-matter or myelination) results are consistent with a role of CNTNAP2 in the establishment of synaptic contacts and other cell-cell contacts especially at Nodes of Ranvier – which are critical for proper function of white-matter tracts that support rapid, long-range neural transmission.  Indeed, more severe mutations in CNTNAP2  have been associated with cortical dysplasia and focal epilepsy (Strauss et al., 2006).

Subtle changes perhaps influencing long-range information flow in my brain – wow!

More on CNTNAP2 … its evolutionary history and role in language development.

Reblog this post [with Zemanta]

Read Full Post »

Diagram to illustrate Minute Structure of the ...
Image via Wikipedia

For a great many reasons, research on mental illness is focused on the frontal cortex.  Its just a small part of the brain, and certainly, many things can go wrong in other places during brain/cognitive development, but, it remains a robust finding, that when the frontal cortex is not working well, individuals have difficulties in regulating thoughts and emotions.  Life is difficult enough to manage, let alone without a well functioning frontal cortex.  So its no surprise that many laboratories look very closely at how this region develops prenatally and during childhood.

One of the more powerful genetic methods is the analysis of gene expression via microarrays (here is a link to a tutorial on this technology).  When this technology is coupled with extremely careful histological analysis and dissection of cortical circuits in the frontal cortex, it begins to become possible to begin to link changes in gene expression with the physiological properties of specific cells and local circuits in the frontal cortex. The reason this is an exciting pursuit is because the mammalian neocortex is organized in a type of layered fashion wherein 6 major layers have different types of connectivity and functionality.  The developmental origins of this functional specificity are thought to lie in a process known as radial migration (here is a video of a neuron as it migrates radially and finds its place in the cortical hierarchy).  As cells are queued out of the ventricular zone, and begin their migration to the cortical surface, they are exposed to all sorts of growth factors and morphogens that help them differentiate and form the proper connectivities.  Thus, the genes that regulate this process are of keen interest to understanding normal and abnormal cognitive development.

Here’s an amazing example of this – 2 papers entitled, “Infragranular gene expression disturbances in the prefrontal cortex in schizophrenia: Signature of altered neural development?” [doi:10.1016/j.nbd.2009.12.013] and “Molecular markers distinguishing supragranular and infragranular layers in the human prefrontal cortex [doi:10.1111/j.1460-9568.2007.05396.x] both by Dominique Arion and colleagues.  In both papers, the authors ask, “what genes are differentially expressed in different layers of the cortex?”.  This is a powerful line of inquiry since the different layers of cortex are functionally different in terms of their connectivity.  For example, layers II-III (the so-called supragranular layers) are known to connect mainly to other cortical neurons – which is different functionally than layers V-VI (the so-called infragranular layers) that connect mainly to the striatum (layer V) and thalamus (layer VI).  Thus, if there are genes whose expression is unique to a layer, then one has a clue as to how that gene might contribute to normal/abnormal information processing.

The authors hail from a laboratory that is well-known for work over many years on fine-scaled histological analysis of the frontal cortex at the University of Pittsburgh and used a method called, laser capture microdissection, where post-mortem sections of human frontal cortex (area 46) were cut to separate the infragraular layer from the supragranular layer.  The mRNA from these tissue sections was then used for DNA microarray hybridization.  Various controls, replicate startegies and in-situ tissue hybridizations were then employed to validate the initial microarray results.

In first paper, the where the authors compare infra vs. supragranular layers, they report that 40 genes were more highly expressed in the supragranular layers (HOP, CUTL2 and MPPE1 were among the most enriched) and 29 genes were highly expressed in the infragranular layers (ZNF312, CHN2, HS3ST2 were among the most enriched).  Other differentially expressed genes included several that have previously been implicated in cortical layer formation such as RLN, TLX-NR2E1, SEMA3E, PCP4, SERPINE2, NR2F2/ARP1, PCDH8, WIF1, JAG1, MBP.  Amazing!! A handful of genes that seem to label subpopulations of projection neurons in the frontal cortex.  Polymorphic markers for these genes would surely be powerful tools for imaging-genetic studies on cognitive development.

In the second paper, the authors compare infra vs. supragranular gene expression in post-mortem brains from patients with schizophrenia and healthy matched controls. Using the same methods, the team reports both supra- and infragranular gene expression changes in schizophrenia (400 & 1200 differences respectively) – more than 70% of the differences appearing to be reductions in gene expression in schizophrenia. Interestingly, the team reports that the genes that were differentially expressed in the infragranular layers provided sufficient information to discriminate between cases and controls, whilst the gene expression differences in the supragranular layers did not.  More to the point, the team finds that 51 genes that were differentially expressed in infra- vs. supragranular expression were also differentially expressed in cases vs. controls  (many of these are also found to be associated in population genetic association studies of schiz vs. control as well!).  Thus, the team has identified layer (function) -specific genes that are associated with schizophrenia.  These genes, the ones enriched in the infragranular layers especially, seem to be at the crux of a poorly functioning frontal cortex.

The authors point to 3 such genes (SEMA3E, SEMA6D, SEMA3C) who happen to members of the same gene family – the semaphorin gene family.  This gene family is very important for the neuronal guidance (during radial migration), morphology, pruning and other processes where cell shape and position are regulated.  The authors propose that the semaphorins might act as “integrators” of various forms of wiring during development and in adulthood.  More broadly, the authors provide a framework to understand how the development of connectivity on the frontal cortex is regulated by genetic factors – indeed, many suspected genetic risk factors play a role in the developmental pathways the authors have focused on.

Reblog this post [with Zemanta]

Read Full Post »

***PODCAST ACCOMPANIES THIS POST***

In his undergraduate writings while a student at Harvard in the early 1900’s E. E. Cummings quipped that, “Japanese poetry is different from Western poetry in the same way as silence is different from a voice”.  Isabelle Alfandary explores this theme in Cummings’ poetry in her essay, “Voice and Silence in E. E. Cummings’ Poetry“,  giving some context to how the poet explored the meanings and consequences of voice and silence.  Take for example, his poem “silence”

silence

.is
a
looking

bird:the

turn
ing;edge, of
life

(inquiry before snow

e.e. cummings

Lately, it seems that the brain imaging community is similarly beginning to explore the meanings and consequences of the brain when it speaks (activations whilst performing certain tasks) and when it rests quietly.  As Cummings beautifully intuits the profoundness of silence and rest,  I suppose he might have been intrigued by just how very much the human brain is doing when we are not speaking, reading, or engaged in a task. Indeed, a community of brain imagers seem to be finding that the brain at rest has quite a lot to say – moreso in people who carry certain forms of genetic variation (related posts here & here).

A paper by Perrson and colleagues “Altered deactivation in individuals with genetic risk for Alzheimer’s disease” [doi:10.1016/j.neuropsychologia.2008.01.026] asked individuals to do something rather ordinary – to pay attention to words – and later to then respond to the meaning of these words (a semantic categorization task). This simple endeavor, which, in many ways uses the very same thought processes as used when reading poetry, turns out to activate regions of the temporal lobe such as the hippocampus and other connected structures such as the posterior cingulate cortex.  These brain regions are known to lose function over the course of life in some individuals and underlie their age-related difficulties in remembering names and recalling words, etc.  Indeed, some have described Alzheimer’s disease as a tragic descent into a world of silence.

In their recordings of brain activity of subjects (60 healthy participants aged 49-79), the team noticed something extraordinary.  They found that there were differences not in how much the brain activates during the task – but rather in how much the brain de-activates – when participants simply stare into a blank screen at a small point of visual fixation.  The team reports that individuals who carry at least one copy of epsilon-4 alleles of the APOE gene showed less de-activation of their their brain (in at least 6 regions of the so-called default mode network) compared to individuals who do not carry genetic risk for Alzheimer’s disease.  Thus the ability of the brain to rest – or transition in and out of the so-called default mode network – seems impaired in individuals who carry higher genetic risk.

So, I shall embrace the poetic wisdom of E. E. Cummings and focus on the gaps, empty spaces, the vastness around me, the silences, and learn to bring my brain to rest.  And in so doing, perhaps avoid an elderly descent into silence.

***PODCAST ACCOMPANIES THIS POST***

Reblog this post [with Zemanta]

Read Full Post »

One of the complexities in beginning to understand how genetic variation relates to cognitive function and behavior is that – unfortunately – there is no gene for “personality”, “anxiety”, “memory” or any other type of “this” or “that” trait.  Most genes are expressed rather broadly across the entire brain’s cortical layers and subcortical systems.  So, just as there is no single brain region for “personality”, “anxiety”, “memory” or any other type of “this” or “that” trait, there can be no such gene.  In order for us to begin to understand how to interpret our genetic make-up, we must learn how to interpret genetic variation via its effects on cells and synapses – that go on to function in circuits and networks.  Easier said than done?  Yes, but perhaps not so intractable.

Here’s an example.  One of the most well studied circuits/networks/systems in the field of cognitive science are so-called basal-ganglia-thalamcortical loops.  These loops have been implicated in a great many forms of cognitive function involving the regulation of everything from movement, emotion and memory to reasoning ability.  Not surprisingly, neuroimaging studies on cognitive function almost always find activations in this circuitry.  In many cases, the data from neuroimaging and other methodologies suggests that one portion of this circuitry – the frontal cortex – plays a role in the representation of such aspects as task rules, relationships between task variables and associations between possible choices and outcomes.  This would be sort of like the “thinking” part of our mental life where we ruminate on all the possible choices we have and the ins and outs of what each choice has to offer.  Have you ever gone into a Burger King and – even though you’ve known for 20 years what’s on the menu – you freeze up and become lost in thought just as its your turn to place your order?  Your frontal cortex is at work!

The other aspect of this circuitry is the subcortical basla ganglia, which seems to play the downstream role of processing all that ruminating activity going on in the frontal cortex and filtering it down into a single action.  This is a simple fact of life – that we can be thinking about dozens of things at a time, but we can only DO 1 thing at a time.  Alas, we must choose something at Burger King and place our order.  Indeed, one of the hallmarks of mental illness seems to be that this circuitry functions poorly – which may be why individuals have difficulty in keeping their thoughts and actions straight – the thinking clearly and acting clearly aspect of healthy mental life.  Certainly, in neurological disorders such as Parkinson’s Disease and Huntington’s Disease, where this circuitry is damaged, the ability to think and move one’s body in a coordinated fashion is disrupted.

Thus, there are at least 2 main components to a complex system/circuits/networks that are involved in many aspects of learning and decision making in everyday life.  Therefore, if we wanted to understand how a gene – that is expressed in both portions of this circuitry – inflenced our mental life, we would have to interpret its function in relation to each specific portion of the circuitry.  In otherwords, the gene might effect the prefrontal (thinking) circuitry in one way and the basla-ganglia (action-selection) circuitry in a different way.  Since we’re all familiar with the experience of walking in to a Burger King and seeing folks perplexed and frozen as they stare at the menu, perhaps its not too difficult to imagine that a gene might differentially influence the ruminating process (hmm, what shall I have today?) and the action selection (I’ll take the #3 combo) aspect of this eveyday occurrance (for me, usually 2 times per week).

Nice idea you say, but does the idea flow from solid science?  Well, check out the recent paper from Cindy M. de Frias and colleagues “Influence of COMT Gene Polymorphism on fMRI-assessed Sustained and Transient Activity during a Working Memory Task.” [PMID: 19642882].  In this paper, the authors probed the function of a single genetic variant (rs4680 is the Methionine/Valine variant of the dopamine metabolizing COMT gene) on cognitive functions that preferentially rely on the prefronal cortex as well as mental operations that rely heavily on the basal-ganglia.  As an added bonus, the team also probed the function of the hippocampus – yet a different set of circuits/networks that are important for healthy mental function.  OK, so here is 1 gene who is functioning  within 3 separable (yet connected) neural networks!

The team focused on a well-studied Methionine/Valine variant of the dopamine metabolizing COMT gene which is broadly expessed across the pre-frontal (thinking) part of the circuitry and the basal-ganglia part of the circuitry (action-selection) as well as the hippocampus.  The team performed a neuroimaging study wherein participants (11 Met/Met and 11 Val/Val) subjects had to view a series of words presented one-at-a-time and respond if they recalled that a word was a match to the word presented 2-trials beforehand  (a so-called “n-back task“).  In this task, each of the 3 networks/circuits (frontal cortex, basal-ganglia and hippocampus) are doing somewhat different computations – and have different needs for dopamine (hence COMT may be doing different things in each network).  In the prefrontal cortex, according to a theory proposed by Robert Bilder and colleagues [doi:10.1038/sj.npp.1300542] the need is for long temporal windows of sustained neuronal firing – known as tonic firing (neuronal correlate with trying to “keep in mind” all the different words that you are seeing).  The authors predicted that under conditions of tonic activity in the frontal cortex, dopamine release promotes extended tonic firing and that Met/Met individuals should produce enhanced tonic activity.  Indeed, when the authors looked at their data and asked, “where in the brain do we see COMT gene associations with extended firing? they found such associations in the frontal cortex (frontal gyrus and cingulate cortex)!

Down below, in the subcortical networks, a differerent type of cognitive operation is taking place.  Here the cells/circuits are involved in the action selection (press a button) of whether the word is a match and in the working memory updating of each new word.  Instead of prolonged, sustained “tonic” neuronal firing, the cells rely on fast, transient “phasic” bursts of activity.  Here, the modulatory role of dopamine is expected to be different and the Bilder et al. theory predicts that COMT Val/Val individuals would be more efficient at modulating the fast, transient form of cell firing required here.   Similarly, when the research team explored their genotype and brain activity data and asked, “where in the brain do we see COMT gene associations with transient firing? they found such associations in the right hippocampus.

Thus, what can someone who carries the Met/Met genotype at rs4680 say to their fellow Val/Val lunch-mate next time they visit a Burger King?  “I have the gene for obesity? or impulsivity? or “this” or “that”?  Perhaps not.  The gene influences different parts of each person’s neural networks in different ways.  The Met/Met having the advantage in pondering (perhaps more prone to annoyingly gaze at the menu forever) whist the Val/Val has the advantage in the action selecting (perhaps ordering promptly but not getting the best burger and fries combo).

Reblog this post [with Zemanta]

Read Full Post »

DON’T tell the grant funding agencies, but, in at least one way, the effort to relate genetic variation to individual differences in cognitive function is a totally intractable waste of money.

Let’s say we ask a population of folks to perform a task – perhaps a word memory task – and then we use neuroimaging to identify the areas of the brain that (i) were associated with performance of the task, and (ii) were not only associated with performance, but were also associated with genetic variation in the population.  Indeed, there are already examples of just this type of “imaging-genetic” study in the literature.  Such studies form a crucial translational link in understanding how genes (whose biochemical functions are most often studied in animal models) relate to human brain function (usually studied with cognitive psychology). However, do these genes relate to just this task? What if subjects were recalling objects? or feelings?  What if subjects were recalling objects / experiences / feelings / etc. from their childhoods?  Of course, there are thousands of common cognitive operations one’s brain routinely performs, and, hence, thousands of experimental paradigms that could be used in such “imaging-genetic” gene association studies.  At more than $500/hour (some paradigms last up to 2 hours) in imaging costs, the translational genes-to-cognition endeavor could get expensive!

DO tell the grant funding agencies that this may not be a problem any longer.

The recent paper by Liu and colleagues “Prefrontal-Related Functional Connectivities within the Default Network Are Modulated by COMT val158met in Healthy Young Adults” [doi: 10.1523/jneurosci.3941-09.2010] suggests an approach that may simplify matters.  Their approach still involves genotyping (in this case for rs4680) and neuroimaging.  However, instead of performing a specific cognitive task, the team asks subjects to lay in the scanner – and do nothing.  That’s right – nothing – just lay still with eyes closed and just let the mind wander and not to think about anything in particular – for a mere 10 minutes.  Hunh?  What the heck can you learn from that?

It turns out that one can learn a lot.  This is because the neural pathways that the brain uses when you are actively doing something (a word recall task) are largely intact even when you are doing nothing.  Your brain does not “turn off” when you are laying still with your eyes closed and drifting in thought.  Rather, your brain slips into a kind of default pattern, described in studies of  “default networks” or “resting-state networks” where wide-ranging brain circuits remain dynamically coupled and actively exchange neural information.  One really great paper that describes these networks is a free-and-open article by Hagmann et al., “Mapping the Structural Core of Human Cerebral Cortex” [doi: 10.1371/journal.pbio.0060159] from which I’ve lifted their Figure 1 above.  The work by Hagmann et al., and others show that the brain has a sort of “connectome” where there are thousands of “connector hubs” or nodes that remain actively coupled (meaning that if one node fires, the other node will fire in a synchronized way) when the brain is at rest and when the brain is actively performing cognitive operations.  In a few studies, it seems that the strength of functional coupling in certain brain areas at rest is correlated (positively and negatively) with the activation of these areas when subjects are performing a specific task.

In the genetic study reported by Liu and colleagues, they found that genotype (N=57) at the dopaminergic COMT gene correlated with differences in the functional connectivity (synchronization of firing) of nodes in the prefrontal cortex.  This result is eerily similar to results found for a number of specific tasks (N-back, Wisconsin Card Sorting, Gambling, etc.) where COMT genotype was correlated with the differential activation of the frontal cortex during the task.  So it seems that one imaging paradigm (lay still and rest for 10 minutes) provided comparable insights to several lengthy (and diverse) activation tasks.  Perhaps this is the case. If so, might it provide a more direct route to linking genetic variation with cognitive function?

Liu and colleagues do not comment on this proposition directly nor do they seem to be over-interpreting their results in they way I have editorialized things here.  They very thoughtfully point out the ways in which the networks they’ve identified and similar and different to the published findings of others.  Certainly, this study and the other one like it are the first in what might be a promising new direction!

Reblog this post [with Zemanta]

Read Full Post »

Darwin's finches or Galapagos finches. Darwin,...
Image via Wikipedia

In his book, The Beak of the Finch, Jonathan Weiner describes the great diversity of finches on the Galapagos Islands – so much diversity – that Darwin himself initially thought the finch variants to be completely different birds (wrens, mockingbirds, blackbirds and “gross-bills”).  It turns out that one of the pivotal events in Charles Darwin‘s life was his work in 1837 with the great ornithologist John Gould who advised that the birds were actually closely related finches and also specific to separate islands!

Fast-forward to 2009, and we are well on our way to understanding how closely related species can, via natural selection of genetic variation, diverge across space and time. The BMP4 and CaM genes, for example, have been associated with beak morphology in what are now known as Darwin’s Finches.  Wonderful indeed, but now consider, for a moment, the variability – not of finch beaks – but of human cognition.

If you’ve ever been a part of a team or group project at work or school, you know that very few people THINK just like you.  Indeed, variability in human cognition can be the source of a lot of frustration.  Let’s face it, people have different experiences stored away (in a highly distributed fashion) in their memory banks, and each persons brain is extensively wired with trillions of synapses.  Of course! nobody thinks like you.  How could such a complex organ function exactly the same way in 2 separate individuals.

Perhaps then, if you were an alien visitor (as Darwin was to the Galapagos Islands) and you watched 5 separate individuals devise a plan to – oh lets just say, to improve healthcare accessibility and affordability – and you measured individuals based solely on their “thinking patterns” you might conclude (as Darwin did) that you were dealing with 5 separate “species”.  Just flip the TV between FOX, CNN, CNBC, CSPAN and MSNBC if you’re not convinced!

However, if you were to take a more in-depth approach and crack open a current issue of a neuroimaging journal – you might come to the exact opposite conclusion.  That’s right.  If you looked at patterns of brain activity and other indirect measures of neural network dynamics (what I casually meant by “thinking patterns” ) you would mostly see conclusions drawn from studies where many individuals are pooled into large groups and then probed for forms of brain activity that are common rather than different.  Most studies today show that humans use a common set of neural systems to perform mental operations (e.g., recalling events and information).  Brain structures including the hippocampus, frontal cortex, thalamus, parietal cortex are all known to be involved in deciding whether or not you have seen something before.  Thus, if you perform an fMRI brain scanning study on individuals and ask them to complete an episodic memory recall task (show them a list of words before scanning and then – when they are in the scanner – ask them to respond to words they remember seeing), you will likely observe that all or most individuals show some BOLD response activity in these structures.

OK great! But can you imagine where we would be if Charles Darwin returned home from his voyage and said, “Oh, just a bunch of birds out there … you know, the usual common stuff … beaks, wings, etc.”  I’d rather not imagine.

Enter Professor Michael Miller and colleagues and their recent paper, “Unique and persistent individual patterns of brain activity across different memory retrieval tasks” [doi:10.1016/j.neuroimage.2009.06.033].  This paper looks – not just at the common stuff – but the individual differences in BOLD responses among individuals who perform a number of different memory tasks.  The team reports that there are dramatic differences in the patterns of brain activity between individuals.  This can be seen very clearly in Figure 1 which shows left hemisphere activity associated with memory recall.  The group data (N=14) show nice clean frontal parietal activations – but when the data is broken down on an individual-by-individual basis, you might – without knowing that the all subjects were performing the same recall tasks – suspect that each person was doing or “thinking” something quite different.  The research team then re-scanned each subject several months later and asked whether the individual differences were consistent from person to person. Indeed, the team shows that the 2nd brain scan is much more similar to the first (correlations were about 0.5) and that the scan-rescan data for an individual was more similar than the correlation between any single person and the rest of the group (about 0.25).  Hence, as the authors state, “unique patterns of brain activity persist across different tasks”.

Vive la difference!  Yes, the variability is – if you’re interested in using genetics to understand human history and cognitive development – the really exciting part!  Of course, genetics is not the main reason for the stable individual-to-individual differences in brain activity.  There are likely to be many factors that could alter the neural dynamics of broadly distributed neural networks used for memory recall.  Environment, experience, gender are just a few factors that are known to influence the function of these networks.  The authors reveal that individuals may also differ in the strategies and criteria they use to make decisions about whether they can recall or detect a previously viewed item.  Some people will respond only when they are very certain (high criteria) and others will respond even if they feel only slightly sure they’ve seen an item before (low criteria).  The authors show in Figure 5 that the folks who showed similar decision criteria are more likely to have similar patterns of brain activity.

Perhaps then, the genetic differences that (partially) underlie individual differences in brain activity might relate to personality or other aspects of decision making?  I don’t have a clue, but I do know that this approach – of looking carefully at individual differences – is a step forward to doing what Darwin (and don’t forget John Gould!) is so well known for.  Understand where the variation comes from, and you will understand where you come from!

I will follow this literature more closely in the months to come.

Reblog this post [with Zemanta]

Read Full Post »

ruler - STUPID INCOMPETENT MANUFACTURERS
Image by Biking Nikon PDX via Flickr

One of the difficult aspects of understanding mental illness, is separating the real causes of the illness from what might be secondary or tertiary consequences of having the illness.  If you think about a car whose engine is not running normally, there may be many observable things going wrong (pinging sound, stalling, smoke, vibration, overheating, loss of power, etc.) – but, what is the real cause of the problem?  What should be done to fix the car? – a faulty sparkplug or timing belt perhaps?  Such is often the problem in medicine, where a fundamental problem can lead to a complex, hard-to-disentangle, etiology of symptoms.  Ideally, you would fix the core problem and then expect the secondary and tertiary consequences to normalize.

This inherent difficulty, particularly in mental illness, is one of the reasons that genetic research is of such interest.  Presumably, the genetic risk factors are deeper and more fundamentally involved in the root causes of the illness – and hence – are preferable targets for treatment.  The recent paper, “Widespread Reductions of Cortical Thickness in Schizophrenia and Spectrum Disorders and Evidence of Heritability” [Arch Gen Psychiatry. 2009;66(5):467-477] seeks to ascertain whether one aspect of schizophrenia – a widespread and well-documented thinning of the neocortex – is due to genetic risk (hence something that is closer to a primary cause) or – rather – if cortical thinning is not due to genetics, and so more of a secondary consequence of things that go wrong earlier in the development of the illness.

To explore this idea, the team of Goldman et al., did something novel.  Rather than examine the differences in cortical thickness between patients and control subjects, the team evaluated the cortical thickness of 59 patients and 72 unaffected siblings as well as 196 unrelated, matched control participants.  If the cortical thickness of the siblings (who share 50% of their genetic variation) was more similar to the patients, then it would suggest that the cortical thinning of the patients was under genetic control and hence – perhaps – a biological trait that is more of a primary cause.  On the other hand, if the cortical thickness of the siblings (who share 0% of their genetic variation) was more similar to that of the healthy control participants, then it would suggest that cortical thinning was – perhaps more of a secondary consequence of some earlier deficit.

The high-resolution structural neuroimaging allowed the team to carefully assess cortical thickness – which is normally between a mere 2 and 4 millimeters – across different areas of the cortex.  The team reports that, for the most part, the cortical thickness measures of the siblings were more similar to the unrelated controls – thus suggesting that cortical thickness may not be a direct component of the genetic risk architecture for schizophrenia.  Still, the paper discusses several candidate mechanisms which could lead to cortical thinning in the illness – some of which might be assessed in the future using other imaging modalities in the context of their patient/sibling/control experimental design.

Reblog this post [with Zemanta]

Read Full Post »

Gravestone of Samuel Coleridge-Taylor,Wallington
Image by sludgegulper via Flickr

Few events are as hard to understand as the loss of a loved one to suicide – a fatal confluence of factors that are oft scrutinized – but whose analysis can provide little comfort to family and friends.  To me, one frightening and vexing aspect of what is known about the biological roots of depression, anxiety, impulsivity and other mental traits and states associated with suicide, is the way in which early life (even prenatal) experience can influence events in later life.  As covered in this blog here and here, there appear to be very early interactions between emotional experience in early life and the methylation of specific points in the genome.  Such methylation – often referred to as epigenetic marks – can regulate the expression of genes that are important for synaptic plasticity and cognitive development.

The recent paper, “Alternative Splicing, Methylation State, and Expression Profile of Tropomyosin-Related Kinase B in the Frontal Cortex of Suicide Completers” is a recent example of a link between epigenetic marks and suicide.  The team of Ernst et al., examined gene expression profiles from the frontal cortex and cerebellum of 28 males lost to suicide and 11 control, ethnically-matched control participants.  Using a subject-by-subject comparison method described as “extreme value analysis” the team identified 2 Affymetrix probes: 221794_at and 221796_at – that are specific to NTRK2 (TRKB) gene – that showed significantly lower expression in several areas of the frontal cortex.  The team also found that these probes were specific to exon 16 – which is expressed only in the TRKB.T1 isoform that is expressed only in astrocytes.

Further analysis showed that there were no genetic differences in the promoter region of this gene that would explain the expression differences, but, however, that there were 2 methylation sites (epigenetic differences) whose methylation status correlated with expression levels (P=0.01 and 0.004).  As a control, the DNA-methylation at these sites was not correlated with TRKB.T1 expression when DNA and RNA was taken from the cerebellum (a control since the cerebellum is not thought to be directly involved in the regulation of mood).

In the case of TRKB.T1 expression, the team reports that more methylation at these 2 sites in the promoter region is associated with less TRKB.T1 expression in the frontal cortex.  Where and when are these marks laid down?  Are they reversible?  How can we know or suspect what is happening to our epigenome (you can’t measure this by spitting into a cup as with current genome sequencing methods)? To me, the team has identified an important clue from which such follow-up questions can be addressed.  Now that they have a biomarker, they can help us begin to better understand our complex and often difficult emotional lives within a broader biological context.

Reblog this post [with Zemanta]

Read Full Post »

ipod
Image by Oliver Lavery via Flickr

Daniel R. Weinberger, M.D., Chief of the Clinical Brain Disorders Branch and Director of the Genes, Cognition and Psychosis Program, National Institute of Mental Health  discusses the background, findings and general issues of genes and mental illness in this brief interview on his paper, “A primate-specific, brain isoform of KCNH2 affects cortical physiology, cognition, neuronal repolarization and risk of schizophrenia”.  Click  HERE for the podcast and HERE for the original post.

Thanks again to Dr. Weinberger for his generous participation!

Reblog this post [with Zemanta]

Read Full Post »

Surgeon holding scalpel.
Image by bethd821 via Flickr

Whether you are a carpenter, plumber, mechanic, electrician, surgeon or chef, your livelihood depends on a set of sturdy, reliable, well-honed, precision tools.  Similarly, neuroscientists depend on their electrodes, brain scanners, microscopes and more recently their genome sequencers.  This is because they are not just trying to dissect the brain – the physical organ – but also the psychological one.  As the billions of neurons connected by trillions of synapses process electrical impulses – a kind of neural information – it is the great endeavor of cognitive-molecular-neuro-psychology (or whatever you wish to call the art) to figure out how all of those neurons and connections come into being and how they process information in ways that lead to your personality, self-image, hopes, dreams, memories and the other wonderful aspects of your mental life.  How and why does information flow through the brain in the way it does? and how and why does it do so in different ways for different people? Some, for instance, have informally related Sigmund Freud‘s models of mental structure to a kind of plumbing wherein psychic energy was routed (or misrouted) through different structural aspects of the mind (pipes as it were).  Perhaps such a model was fitting for the great industrial era in which he lived – but perhaps not in today’s highly information-based, inter-connected and network-oriented era.  If our understanding of mental life is a product of our tools, then perhaps we should be sure that our modern tools are up to the job.

One recent paper reminded me of how important it is to double check the accuracy and precision of one’s tools was the research article, “Quantifying the heritability of task-related brain activation and performance during the N-back working memory task: A twin fMRI study” [doi:10.1016/j.biopsycho.2008.03.006] by Blokland et al..  In this report, the team summarizes the results of measurments of the brain activity – not structure – but rather activity as measured by their chosen tool, the MRI scanner.  This research team, based in UCLA and known as one of the best in the field, asks whether the so-called BOLD response (an indirect measure of neural activity) shows greater concordance in identical (monozygotic) vs. fraternal (dizygotic) twins.  To generate brain activity, the research team asked the subjects to perform a task called an N-back  workng memory task, which entails having to remember something that happend “N” times ago (click here for further explanation of N-back task or play it on your iphone).  If you’ve done this, you’ll know that its hard – maddeningly so – and it requires a lot of concentration, which, the researchers were counting on to generate activity in the prefrontal cortex.

After looking at the brain activity patterns of some 29 MZ pairs and 31 DZ pairs, the team asked if the patterns of brain activity in the lateral frontal cortex were more similar in the MZ pairs vs. the DZ pairs.  If so, then it would suggest that the scanning technology (measurement of the BOLD response) is sufficiently reliable and precise enough to detect the fraction of individual differences in brain activty that arise from additive genetic variation.  If one actually had such super-precise tool, then one could begin to dissect and tease apart aspects of human cognition that are regulated by individual genetic variation – a very super-precise and amazing tool – that might allow us to understand mental life in biologically-based terms (and not Freud’s plumbingesque analogies).  If only such a tool existed! Somewhat amazingly, the scanning tools did seem to be able to detect differences between the BOLD response correlations of MZ pairs vs. DZ pairs.  The BOLD response correlations were greater for MZ vs. DZ in the middle frontal gyrus, angular gyrus, supramarginal gyrus when activity for the 2-back task was compared to the 0-back task.  The team were cautious to extend these findings too far, since the standard deviations are large and the estimates of heritability for the BOLD response are rather low (11-36%), but, overall, the team suggests that the ability to use the fMRI methods in conjunction with genetic markers shows future promise.

Meanwhile, the literature of so-called “imaging-genetic” findings begins to grow in the literature.  I hope the tools are reliable and trustworthy enough to justify conclusions and lessons about human genetic variation and its role in mental life.  Will certainly keep this cautionary report in mind as I report on the cognitive genetics literature in the future.

Reblog this post [with Zemanta]

Read Full Post »

[picapp src=”e/7/8/1/Children_Attend_Classes_9572.jpg?adImageId=4955179&imageId=1529412″ width=”380″ height=”253″ /]

This year, my 5 year-old son and I have passed many afternoons sitting on the living room rug learning to read.  While he ever so gradually learns to decode words, eg. “C-A-T”  sound by sound, letter by letter – I can’t help but marvel at the human brain and wonder what is going on inside.  In case you have forgotten, learning to read is hard – damn hard.  The act of linking sounds with letters and grouping letters into words and then words into meanings requires a lot of effort from the child  (and the parent to keep discomfort-averse child in one place). Recently, I asked him if he could spell words in pairs such as “MOB & MOD”, “CAD & CAB”, “REB & RED” etc., and, as he slowly sounded out each sound/letter, he informed me that “they are the same daddy“.  Hence, I realized that he was having trouble – not with the sound to letter correspondence, or the grouping of the letters, or the meaning, or handwriting – but rather – just hearing and discriminating the -B vs. -D sounds at the end of the word pairs.  Wow, OK, this was a much more basic aspect of literacy – just being able to hear the sounds clearly.  So this is the case, apparently, for many bright and enthusiastic children, who experience difficulty in learning to read.  Without the basic perceptual tools to hear “ba” as different from “da” or “pa” or “ta” – the typical schoolday is for naught.

With this in mind, the recent article, “Genetic determinants of target and novelty-related event-related potentials in the auditory oddball response” [doi:10.1016/j.neuroimage.2009.02.045] caught my eye.  The research team of Jingyu Liu and colleagues asked healthy volunteers just to listen to a soundtrack of meaningless beeps, tones, whistles etc.  The participants typically would hear a long stretch of the same sound eg. “beep, beep, beep, beep” with a rare oddball “boop” interspersed at irregular intervals.  The subjects were instructed to simply press a button each time they heard an oddball stimulus.  Easy, right?  Click here to listen to an example of an “auditory oddball paradigm” (though not one from the Liu et al., paper).  Did you hear the oddball?  What was your brain doing? and what genes might contribute to the development of this perceptual ability?

The researchers sought to answer this question by screening 41 volunteers at 384 single nucleotide polymorphisms (SNPs) in 222 genes selected for their metabolic function in the brain.  The team used electroencephalogram recordings of brain activity to measure differences in activity for “boop” vs. “beep” type stimuli – specifically, at certain times before and after stimulus onset – described by the so-called N1, N2b, P3a, P3b component peaks in the event-related potentials waveforms.  800px-Erp1Genotype data (coded as 1,0,-1 for aa, aA, AA) and EEG data were plugged into the team’s home-grown parallel independent components analysis (ICA) pipeline (generously provided freely here) and several positives were then evaluated for their relationships in biochemical signal transduction pathways (using the Ingenuity Pathway Analysis toolkit.  A very novel and sophisticated analytical method for certain!

The results showed that certain waveforms, localized to certain areas of the scalp were significantly associated with the perception of various oddball “boop”-like stimuli.  For example, the early and late P3 ERP components, located over the frontal midline and parieto-occipital areas, respectively, were associated with the perception of oddball stimuli.  Genetic analysis showed that several catecholaminergic SNPs such as rs1800545 and rs521674 (ADRA2A), rs6578993 and rs3842726 (TH) were associated with both the early and late P3 ERP component as well as other aspects of oddball detection.

Both of these genes are important in the synaptic function of noradrenergic and dopaminergic synapses. Tyrosine hydroxylase, in particular, is a rate-limiting enzyme in catecholamine synthesis.  Thus, the team has identified some very specific molecular processes that contribute to individual differences in perceptual ability.  In addition to the several other genes they identified, the team has provided a fantastic new method to begin to crack open the synaptic complexities of attention and learning.  See, I told you learning to read was hard!

Reblog this post [with Zemanta]

Read Full Post »

FTM_phase_locking_v4_0**PODCAST accompanies this post** In the brain, as in other aspects of life, timing is everything.  On an intuitive level, its pretty clear, that, since neurons have to work together in widely distributed networks, they have a lot of incentive to talk to each other in a rhythmic, organized way. Think of a choir that sings together vs. a cacophony of kids in a cafeteria – which would you rather have as your brain? A technical way of saying this could be, “Clustered bursting oscillations, with in-phase synchrony within each cluster, have been proposed as a binding mechanism. According to this idea, neurons that encode a particular stimulus feature synchronize in the same cluster.”  A less technical way of saying this was first uttered by Carla Shatz who said, “Neurons that fire together wire together” and “Neurons that fire apart wire apart“.  So it seems, that the control over neural timing and synchronicity – the rushing “in” of Na+ ions and rushing “out” of K+ ions that occur during cycles of depolarization and repolarization of an action potential take only a few milliseconds – is something that neurons would have tight control over.

With this premise in mind, it is fascinating to ponder some recent findings reported by Huffaker et al. in their research article, “A primate-specific, brain isoform of KCNH2 affects cortical physiology, cognition, neuronal repolarization and risk of schizophrenia” [doi: 10.1038/nm.1962].  Here, the research team has identified a gene, KCNH2, that is both differentially expressed in brains of schizophrenia patients vs. healthy controls and that contains several SNP genetic variants (rs3800779, rs748693, rs1036145) that are associated with multiple different patient populations.  Furthermore, the team finds that the risk-associated SNPs are associated with greater expression of an isoform of KCNH2 – a kind of special isoform – one that is expressed in humans and other primates, but not in rodents (they show a frame-shift nucleotide change that renders their ATG start codon out of frame and their copy non-expressed).  Last I checked, primates and rodents shared a common ancestor many millenia ago. Very neat – since some have suggested that newer evolutionary innovations might still have some kinks that need to be worked out.

In any case, the research team shows that the 3 SNPs are associated with a variety of brain parameters such as hippocampal volume, hippocampal activity (declarative memory task) and activity in the dorsolateral prefrontal cortex (DLPFC). The main suggestion of how these variants in KCNH2 might lead to these brain changes and risk for schizophrenia comes from previous findings that mutations in this gene screw up the efflux of K+ ions during the repolarization phase of an action potential.  In the heart (where KCNH2 is also expressed) this has been shown to lead to a form of “long QT syndrome“.  Thus, the team explores this idea using primary neuronal cell cultures and confirms that greater expression of the primate isoform leads to non-adaptive, quickly deactivating, faster firing patterns, presumably due to the extra K+ channels. 

The authors hint that fast & extended spiking is – in the context of human cognition – is thought to be a good thing since its needed to allow the binding of multiple input streams.  However, in this case, the variants seem to have pushed the process to a non-adaptive extreme.  Perhaps there is a seed of an interesting evolutionary story here, since the innovation (longer, extended firing in the DLPFC) that allows humans to ponder so many ideas at the same time, may have some legacy non-adaptive genetic variation still floating around in the human lineage.  Just a speculative muse – but fun to consider in a blog post.

In any case, the team has substantiated a very plausible mechanism for how the genetic variants may give rise to the disorder.  A scientific tour-de-force if there ever was one.

On a personal note, I checked my 23andMe profile and found that while rs3800779 and rs748693 were not assayed, rs1036145 was, and I – boringly – am a middling G/A heterozygote.  In this article, the researchers find that the A/As showed smaller right-hippocampal grey matter volume, but the G/A were not different that the G/Gs.  During a declarative memory task, the GGs showed little or no change in hippocampal activity while the AA and GA group showed changes – but only in the left hippocampus.  In the N-back task (a working memory task), the AA’s showed more changes in brain activation in the right DLPFC compared to the GGs and GAs.

For further edification, here is a video showing the structure of the KCNH2-type K+ channel.  Marvel at the tiny pore that allows red K+ ions to leak through during the repolarization phase of an action potential.   **PODCAST accompanies this post**

Reblog this post [with Zemanta]

Read Full Post »

Pyramidal cell -  A human neocortical pyramida...
Image via Wikipedia

Among the various (and few) significant results of recent landmark whole-genome analyses (involving more than 54,000 participants) on schizophrenia (covered here and here), there was really just one consistent result – linkage to the 6p21-22 region containing the immunological MHC loci.  While there has been some despair among professional gene hunters, one man’s exasperation can sometimes be a source of great interest and opportunity for others – who – for many years – have suspected that early immunological infection was a key risk factor in the development of the disorder.

Such is the case in the recent paper, “Prenatal immune challenge induces developmental changes in the morphology of pyramidal neurons of the prefrontal cortex and hippocampus in rats” by Baharnoori et al., [doi: 10.1016/j.schres.2008.10.003].  In this paper, the authors point out that Emil Kraepelin, who first described the disorder we now call schizophrenia, had suggested that childhood inflammation of the head might be an important risk factor.  Thus, the immunopathological hypothesis has been around since day 0 – a long time coming I suppose.

In their research article, Baharnoori and colleagues have taken this hypothesis and asked, in a straightforward way, what the consequences of an immunological challenge on the developing brain might look like.  To evaluate this question, the team used a Sprague-Dawley rat model and injected pregnant females (intraperitoneally on embryonic day 16) with a substance known as lipopolysaccharide (LPS) which is known to mimic an infection and initiate an immune response (in a manner that would normally depend on the MHC loci found on 6p21-22). Once the injections were made, the team was then able to assess the consequences to various aspects of brain and behavior.

In this paper, the team focused their analysis on the development of the frontal cortex and the hippocampus – 2 regions that are known to function poorly in schizophrenia.  They used a very, very focused probe of development – namely the overall shape, branching structure and spine formations on pyramidal cells in these regions – via a method known as Golgi-Cox staining.  The team presents a series of fantastically detailed images of single pyramidal cells (taken from postnatal day 10, 35 and 60) from animals who’s mothers were immunologically challenged and those who were unexposed to LPS.

Briefly, the team finds that the prenatal exposure to LPS had the effect of reducing the number of dendritic spines (these are the aspects of a neuron that are used to make synaptic connections with other neurons) in the developing offspring.  Other aspects of neuronal shape were also affected in the treated animals – basically amounting to a less branchy, less spiny – less connectable – neuron.  If that’s not a basis for a cognitive disorder than what else is?  Indeed, the authors point out that such spines are targets – in early development – for interneurons that are essential for long-range gamma oscillations that help distant brain regions function together in a coherent manner (something that notably does not happen in schizophrenia).

Thus, there is many a reason (54,000 strong) to want to better understand the neuro-immuno-genetic-developmental mechanisms that can alter neuronal structure.  Exciting progress in the face of recent genetic setbacks!
mineshaft_comic

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »