Feeds:
Posts
Comments

Posts Tagged ‘Frontal lobe’

You mean these types of executives?  No … well, sort of, maybe.  Some people can control their thoughts and actions better than others.

Individuals vary widely in their abilities to control their own thoughts and actions. Some people seem ruled by impulses, while others manage successfully to regulate their behaviors. From the perspective of cognitive psychology, such variation reflects individual differences in executive functions, a collection of correlated but separable control processes that regulate lower-level cognitive processes to shape complex performance.

Results indicated that executive functions are correlated because they are influenced by a highly heritable (99%) common factor that goes beyond general intelligence or perceptual speed, and they are separable because of additional genetic influences unique to particular executive functions. This combination of general and specific genetic influences places executive functions among the most heritable psychological traits.

Read Full Post »

… but you knew that already.  Here’s an example of how a phenomenon known as exon shufflin’ can lead to evolutionary diversity (here involving SNAP25‘s exon 5a variant for early brain development while the exon 5b variant is used later in development) .  Perhaps we owe our awesome, ahem, “higher” cognitive abilities to this ancient exon duplication … video below notwithstanding.

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Where's Waldo in Google Maps?
Image by Si1very via Flickr

In an earlier post on Williams Syndrome, we delved into the notion that sometimes a genetic variant can lead to enhanced function – such as certain social behaviors in the case of WS.  A mechanism that is thought to underlie this phenomenon has to do with the way in which information processing in the brain is widely distributed and that sometimes a gene variant can impact one processing pathway, while leaving another pathway intact, or even upregulated.  In the case of Williams Syndrome a relatively intact ventral stream (“what”) processing but disrupted dorsal stream (“where”) processing leads to weaker projections to the frontal cortex and amygdala which may facilitate gregarious and prosocial (a lack of fear and inhibition) behavior.  Other developmental disabilities may differentially disrupt these 2 visual information processing pathways.  For instance, developmental dyspraxia contrasts with WS as it differentially disrupts the ventral stream processing pathway.

A recent paper by Woodcock and colleagues in their article, “Dorsal and ventral stream mediated visual processing in genetic subtypes of Prader–Willi syndrome” [doi:10.1016/j.neuropsychologia.2008.09.019] ask how another developmental disability – Prader-Willi syndrome – might differentially influence the development of these information processing pathways.  PWS arises from the lack of expression (via deletion or uniparental disomy) of a cluster of paternally expressed genes in the 15q11-13 region (normally the gene on the maternally inherited chromosome is silent, or imprintedrelated post here).  By comparing PWS children to matched controls, the team reports evidence showing that PWS children who carry the deletion are slightly more impaired in a task that depends on the dorsal “where” pathway whilst some sparing or relative strength in the ventral “what” pathway.

Reblog this post [with Zemanta]

Read Full Post »

An historic find has occurred in the quest (gold-rush, if you will) to link genome variation with brain structure-function variation.  This is the publication of the very first genome-wide (GWAS) analysis of individual voxels (voxels are akin to pixels in a photograph, but are rather 3D cubes of brain-image-space about 1mm on each side) of brain structure – Voxelwise genome-wide association study (vGWAS) [doi: 10.1016/j.neuroimage.2010.02.032] by Jason Stein and colleagues under the leadership of Paul M. Thompson, a  leader in the area of neuroimaging and genetics – well-known for his work on brain structure in twin and psychiatric patient populations.

In an effort to discover genes that contribute to individual differences in brain structure, the authors took on the task of statistically analyzing the some 31,622 voxels (per brain) obtained from high-resolution structural brain scans; with 448,293 Illumina SNP genotypes (per person) with minor allele frequencies greater than 0.1 (common variants); in 740 unrelated healthy caucasian adults.  When performed on a voxel-by-voxel basis, this amounts to some 14 billion statistical tests.

Yikes!  A statistical nightmare with plenty of room for false positive results, not to mention the recent disillusionment with the common-variant GWAS approach?  Certainly.  The authors describe these pitfalls and other scenarios wherein false data is likely to arise and most of the paper addresses the pros and cons of different statistical analysis strategies – some which are prohibitive in their computational demands.  Undaunted, the authors describe several approaches for establishing appropriate thresholds and then utilize a ‘winner take all’ analysis strategy wherein a single ‘most-associated winning snp’ is identified for each voxel, which when clustered together in hot spots (at P = 2 x 10e-10), can point to specific brain areas of interest.

Using this analytical approach, the authors report that 8,212 snps were identified as ‘winning, most-associated’ snps across the 31,622 voxels.  They note that there was not as much symmetry with respect to winning snps in the left hemispere and corresponding areas in the right hemisphere, as one might have expected.  The 2 most significant snps across the entire brain and genome were rs2132683 and rs713155 which were associated with white matter near the left posterior lateral ventricle.  Other notable findings were rs2429582 in the synaptic (and possible autism risk factor) CADPS2 gene which was associated with temporal lobe structure and rs9990343 which sits in an intergenic region but is associated with frontal lobe structure.  These and several other notable snps are reported and brain maps are provided that show where in the brain each snp is associated.

As in most genome-wide studies, one can imagine that the authors were initially bewildered by their unexpected findings.  None of the ‘usual suspects’ such as neurotransmitter receptors, transcription factors, etc. etc. that dominate the psychiatric genetics literature.  Bewildered, perhaps, but maybe thats part of the fun and excitement of discovery!  Very exciting stuff to come I’ll bet as this new era unfolds!

Reblog this post [with Zemanta]

Read Full Post »

According to wikipedia, “Jean Philippe Arthur Dubuffet (July 31, 1901 – May 12, 1985) was one of the most famous French painters and sculptors of the second half of the 20th century.”  “He coined the term Art Brut (meaning “raw art,” often times referred to as ‘outsider art’) for art produced by non-professionals working outside aesthetic norms, such as art by psychiatric patients, prisoners, and children.”  From this interest, he amassed the Collection de l’Art Brut, a sizable collection of artwork, of which more than half, was painted by artists with schizophrenia.  One such painting that typifies this style is shown here, entitled, General view of the island Neveranger (1911) by Adolf Wolfe, a psychiatric patient.

Obviously, Wolfe was a gifted artist, despite whatever psychiatric diagnosis was suggested at the time.  Nevertheless, clinical psychiatrists might be quick to point out that such work reflects the presence of an underlying thought disorder (loss of abstraction ability, tangentiality, loose associations, derailment, thought blocking, overinclusive thinking, etc., etc.) – despite the undeniable aesthetic beauty in the work.  As an ardent fan of such art,  it made me wonder just how “well ordered” my own thoughts might be.  Given to being rather forgetful and distractable, I suspect my thinking process is just sufficiently well ordered to perform the routine tasks of day-to-day living, but perhaps not a whole lot more so.  Is this bad or good?  Who knows.

However, Krug et al., in their recent paper, “The effect of Neuregulin 1 on neural correlates of episodic memory encoding and retrieval” [doi:10.1016/j.neuroimage.2009.12.062] do note that the brains of unaffected relatives of persons with mental illness show subtle differences in various patterns of activation.  It seems that when individuals are using their brains to encode information for memory storage, unaffected relatives show greater activation in areas of the frontal cortex compared to unrelated subjects.  This so-called encoding process during episodic memory is very important for a healthy memory system and its dysfunction is correlated with thought disorders and other aspects of cognitive dysfunction.  Krug et al., proceed to explore this encoding process further and ask if a well-known schizophrenia risk variant (rs35753505 C vs. T) in the neuregulin-1 gene might underlie this phenomenon.  To do this, they asked 34 TT, 32 TC and 28 CC individuals to perform a memory (of faces) game whilst laying in an MRI scanner.

The team reports that there were indeed differences in brain activity during both the encoding (storage) and retrieval (recall) portions of the task – that were both correlated with genotype – and also in which the CC risk genotype was correlated with more (hyper-) activation.  Some of the brain areas that were hyperactivated during encoding and associated with CC genotype were the left middle frontal gyrus (BA 9), the bilateral fusiform gyrus and the left middle occipital gyrus (BA 19).  The left middle occipital gyrus showed gene associated-hyperactivation during recall.  So it seems, that healthy individuals can carry risk for mental illness and that their brains may actually function slightly differently.

As an ardent fan of Art Brut, I confess I hoped I would carry the CC genotype, but alas, my 23andme profile shows a boring TT genotype.  No wonder my artwork sucks.  More on NRG1 here.

Reblog this post [with Zemanta]

Read Full Post »

wotd044
Image by theloushe via Flickr

** PODCAST accompanies this post**

I have a little boy who loves to run and jump and scream and shout – a lot.  And by this, I mean running – at full speed and smashing his head into my gut,  jumping – off the couch onto my head,  screaming – spontaneous curses and R-rated body parts and bodily functions.  I hope you get the idea.  Is this normal? or (as I oft imagine) will I soon be sitting across the desk from a school psychologist pitching me the merits of an ADHD diagnosis and medication?

Of course, when it comes to behavior, there is not a distinct line one can cross from normal to abnormal.  Human behavior is complex, multi-dimensional and greatly interpreted through the lens of culture.  Our present culture is highly saturated by mass-marketing, making it easy to distort a person’s sense of “what’s normal” and create demand for consumer products that folks don’t really need (eg. psychiatric diagnoses? medications?).   Anyhow, its tough to know what’s normal.  This is an important issue to consider for those (mass-marketing hucksters?) who might be inclined to promote genetic data as “hard evidence” for illness, disorder or abnormality of some sort.

With this in mind, I really enjoyed a recent paper by Stollstorff et al., “Neural response to working memory load varies by dopamine transporter genotype in children” [doi:10.1016/j.neuroimage.2009.12.104] who asked how the brains of healthy children functioned, even though they carry a genotype that has been widely associated with the risk of ADHD.  Healthy children who carry genetic risk for ADHD. Hmm, might this be my boy?

The researchers looked at a 9- vs. 10-repeat VNTR polymorphism in the 3′-UTR of the dopamine transporter gene (DAT1).  This gene – which encodes the very protein that is targeted by so many ADHD medications – influences the re-uptake of dopamine from the synaptic cleft.  In the case of 10/10 genotypes, it seems that DAT1 is more highly expressed, thus leading to more re-uptake and hence less dopamine in the synaptic cleft.  Generally, dopamine is needed to enhance the signal/noise of neurotransmission, so – at the end of the day – the 10/10 genotype is considered less optimal than the 9/9-repeat genotype.  As noted by the researchers, the ADHD literature shows that the 10-repeat allele, not the 9-repeat, is most often associated with ADHD.

The research team asked these healthy children (typically developing children between 7 and 12 years of age) to perform a so-called N-back task which requires that children remember words that are presented to them one-at-a-time.  Each time a new word is presented, the children had to decide whether that word was the same as the previous word (1-back) or the previous, previous word (2-back).  Its a maddening task and places an extreme demand on neural circuits involved in active maintenance of information (frontal cortex) as well as inhibition of irrelevant information that occurs during updating (basal ganglia circuits).

As the DAT1 protein is widely expressed in the basal ganglia, the research team asked where in the brain was variation in the DAT1 (9- vs. 10-repeat) associated with neural activity?  and where was there a further difference between 1-back and 2-back?  Indeed, the team finds that brain activity in many regions of the basal ganglia (caudate, putamen, substantia nigra & subthalamic nucleus) were associated with genetic variation in DAT1.  Neat!  the gene may be exerting an influence on brain function (and behavior) in healthy children, even though they do not carry a diagnosis.  Certainly, genes are not destiny, even though they do influence brain and behavior.

What was cooler to me though, is the way the investigators examined the role of genetic variation in the 1-back (easy or low load condition) vs. 2-back (harder, high-load condition) tasks.  Their data shows that there was less of an effect of genotype on brain activation in the easy tasks.  Rather, only when the task was hard, did it become clear that the basal ganglia in the 10/10 carriers was lacking the necessary brain activation needed to perform the more difficult task.  Thus, the investigators reveal that the genetic risk may not be immediately apparent under conditions where heavy “loads” or demands are not placed on the brain.  Cognitive load matters when interpreting genetic data!

This result made me think that genes in the brain might be a lot like genes in muscles.  Individual differences in muscle strength are not associated with genotype when kids are lifting feathers.  Only when kids are actually training and using their muscles, might one start to see that some genetically advantaged kids have muscles that strengthen faster than others.  Does this mean there is a “weak muscle gene” – yes, perhaps.  But with the proper training regimen, children carrying such a “weak muscle gene” would be able to gain plenty of strength.

I guess its off to the mental and physical gyms for me and my son.

** PODCAST accompanies this post** also, here’s a link to the Vaidya lab!

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »