Feeds:
Posts
Comments

Posts Tagged ‘Gene expression’

Who knew?  Reinius and colleagues have discovered where she’s kept it stashed away … in 85 brain-expressed genes they refer to as a conserved sexual signature … tsk tsk naughty.  Ladies, you can skip over the parts about macho men with rippling muscles and power tools … ’cause apparently, what really turns Mother Nature on is polyamine biosynthesis.

Read Full Post »

Hey Yin, we have a genome and a brain … what’s the relaionship?

I dunno Yang.  Lets focus on variation.  Genome sequence variation can vary with the brain  … and … gene expression can vary with the brain  … however … genome sequence variation can vary with gene expression … but … here’s a paper showing that gene expression is under the control of genome sequence variation. Purrrr.

Hey Yin, the correlation between genome sequence variation and gene expression confuses me.  I mean, gene expression can change if the environment changes right?  Doesn’t this confound research that uses genome sequence variation?

Meow.

thanks for the pic noyfb.

Enhanced by Zemanta

Read Full Post »

Myelin Repair Foundation Logo
Image by Myelin Repair Foundation via Flickr

from Ye et al., 2009:

HDAC1/2 genes encode proteins that modify the epigenome (make it less accessible for gene expression).

When HDAC1/2 functions around the HES5 and ID2/4 (repressors of white matter development) genes, the epigenetic changes (less acetylation of chromatin) helps to repress the repressors.

This type of epigenetic repression of gene expression (genes that repress white matter development) is essential for white matter development.

Enhanced by Zemanta

Read Full Post »

Modified drawing of the neural circuitry of th...
Image via Wikipedia

You already know this, but when you are stressed out (chronic stress), your brain doesn’t work very wellThat’s right – just when you need it most – your brain has a way of letting you down!

Here are a few things that happen to the very cells (in the hippocampus) that you rely on:

reorganization within mossy fiber terminals
loss of excitatory glutamatergic synapses
reduction in the surface area of postsynaptic densities
marked retraction of thorny excrescences
alterations in the lengths of the terminal dendritic segments of pyramidal cells
reduction of the dorsal anterior CA1 area volume

Thanks brain!  Thanks neurons for abandoning me when I need you most!  According to this article, these cellular changes lead to, “impaired hippocampal involvement in episodic, declarative, contextual and spatial memory – likely to debilitate an individual’s ability to process information in new situations and to make decisions about how to deal with new challenges.” UGH!

Are our cells making these changes for a reason?  Might it be better for cells to remodel temporarily rather than suffer permanent, life-long damage?  Perhaps.  Perhaps there are molecular pathways that can lead the reversal of these allostatic stress adaptations?

Check out this recent paper: “A negative regulator of MAP kinase causes depressive behavior” [doi 10.1038/nm.2219]  the authors have identified a gene – MKP-1 – a phosphatase that normally dephosphorylates various MAP kinases involved in cellular growth, that, when inactivated in mice, produces animals that are resistant to chronic unpredictable stress.  Although its known that MKP-1 is needed to limit immune responses associated with multi-organ failure during bacterial infections, the authors suggest:

“pharmacological blockade of MKP-1 would produce a resilient of anti-depressant response to stress”

Hmmm … so Mother Nature is using the same gene to regulate the immune response (turn it off so that it doesn’t damage the rest of the body) and to regulate synaptic growth (turn it off – which is something we DON’T want to do when we’re trying to recover from chronic stress)?  Mother Nature gives us MKP-1 so I can survive an infection, but the same gene prevents us from recovering (finding happiness) from stress?

Of course, we do not need to rely only on pharmacological solutions.  Exercise & social integration are cited by these authors as the top 2 non-medication strategies.

Enhanced by Zemanta

Read Full Post »

remember a day before today
Image by DerrickT via Flickr

Most cells in your adult body are “terminally differentiated” – meaning that they have developed from stem cells into the final liver, or heart, or muscle or endothelial cell that they were meant to be.  From that point onward, cells are able to “remember” to stay in this final state – in part – via stable patterns of DNA methylation that reinforce the regulation of “the end state” of gene expression for that cell.  As evidence for this role of DNA methylation, it has been observed that levels of DNA methyl transferase (DNMT) decline when cells are fully differentiated and thus, cannot modify or disrupt their patterns of methylation.

NOT the case in the brain! Even though neurons in the adult brain are fully differentiated, levels of methyl transferases – DO NOT decline.  Why not? Afterall, we wouldn’t want our neurons to turn into liver cells, or big toe cells, would we?

One hypothesis, suggested by David Sweatt and colleagues is that neurons have more important things to “remember”.   They suggest in their fee and open research article, “Evidence That DNA (Cytosine-5) Methyltransferase Regulates Synaptic Plasticity in the Hippocampus” [doi: 10.1074/jbc.M511767200] that:

DNA methylation could have lasting effects on neuronal gene expression and overall functional state. We hypothesize that direct modification of DNA, in the form of DNA (cytosine-5) methylation, is another epigenetic mechanism for long term information storage in the nervous system.

By measuring methylated vs. unmethylated DNA in the promoter of the reelin and BDNF genes and relating this to electrophysiological measures of synaptic plasticity, the research team finds correlations between methylation status and synaptic plasticity.  More specifically, they find that zebularine (an inhibitor of DNMT) CAN block long-term potentiation (LTP), but NOT block baseline synaptic transmission nor the ability of synapses to fire in a theta-burst pattern (needed to induce LTP).

This suggests that the epigenetic machinery used for DNA methylation may have a role in the formation of cellular memory – but not in the same sense as in other cells in the body – where cells remember to remain in a terminally differentiated state.

In the brain, this epigenetic machinery may help cells remember stuff that’s more germane to brain function … you know … our memories and stuff.

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Cinematicode wall
Image by Smeerch via Flickr

As far as science movies go, the new movie, “To Age or Not To Age” seems like a lot of fun.  The interview with Dr. Leonard Guarente suggests that the sirtuin genes play a starring role in the film.  Certainly,  an NAD+ dependent histone deacetylase – makes for a sexy movie star – especially when it is able to sense diet and metabolism and establish the overall lifespan of an organism.

One comment in the movie trailer, by Aubrey de Grey, suggests that humans may someday be able to push the physiology of aging to extreme ends.  That studies of transgenic mice over-expressing SIRT1 showed physiological properties of calorie-restricted (long lived) mice – even when fed ad libitum – suggests that something similar might be possible in humans.

Pop a pill and live it up at your local Denny’s for the next 100 years?  Sounds nice (& a lot like grad school).

Just a few twists to the plot here.  It turns out that – in the brain – SIRT1 may not function as it does in the body.  Here’s a quote from a research article “Neuronal SIRT1 regulates endocrine and behavioral responses to calorie restriction” that inactivated SIRT1 just in the brain:

Our findings suggest that CR triggers a reduction in Sirt1 activity in hypothalamic neurons governing somatotropic signaling to lower this axis, in contrast with the activation of Sirt1 by CR in many other tissues. Sirt1 may have evolved to positively regulate the somatotropic axis, as it does insulin production in β cells, to control mammalian health span and life span in an overarching way. However, the fact that Sirt1 is a positive regulator of the somatotropic axis may complicate attempts to increase murine life span by whole-body activation of this sirtuin.

To a limited extent, it seems that – in the brain – SIRT1 has the normal function of promoting aging.  Therefore, developing “pills” that are activators of SIRT1 would be good for the body, but somehow might be counteracted by what the brain would do.  Who’s in charge anyway?  Mother Nature will not make it easy to cheat her! Another paper published recently also examined the role of SIRT1 in the brain and found that – normally – SIRT1 enhances neuronal plasticity (by blocking the expression of a  micro-RNA miR-134 that binds to the mRNA of, and inhibits the translation of, synaptic plasticity proteins such as CREB).

So, I won’t be first to line up for SIRT1 “activator” pills (such as Resveratrol), but I might pop a few if I’m trying to learn something new.

Enhanced by Zemanta

Read Full Post »

Older Posts »