Feeds:
Posts
Comments

Posts Tagged ‘Anxiety’

rs17536211 and recovery from eating disorders

Posted in Amygdala, GABRG1, Uncategorized, tagged , , , , , , , on December 12, 2012| Leave a Comment »

6377650365_0a712cf431_z

Genes that confer risk for illness are ideal targets for prevention and treatment.  So, also, are genes associated with natural or treatment-based RECOVERY from illness.  In a search for “recovery genes”, association studies in women who have recovered from eating disorders (ED) vs. those who are still struggling to recover reveals that the C-allele of rs17536211 is associated with recovery.

From Bloss et al.:  “Given the substantial genetic component in the etiology of EDs in general, it follows that there may be genetic variants that contribute to the likelihood of recovery.”

“These were women who were over age 25 years, carried a lifetime diagnosis of either AN, BN, or ED-NOS (ie, subthreshold AN or BN), and for whom data were available regarding the presence (n=361 endorsed ongoing ED symptoms in the past year and considered ‘ill’) or absence (n=115 no ED symptoms in the past year and considered ‘recovered’) of ED symptoms.”

“rs17536211, an intronic SNP in GABRG1 on chromosome 4, showed the strongest statistical evidence of association with a GC-corrected p-value of 4.63 × 10−6, which corresponds to an FDR of 0.021 (Figure 1). The odds ratio (OR) observed for this SNP is 0.46, suggesting that possession of copies of the minor allele [C] is protective from long-term chronic illness (ie, it is associated with recovery).”

How might this SNP confer a protective effect?  The authors review data on the role of GABRG1 subunits in the un-learning of conditioned fear responses [“GABRG1 subunits are found in the lateral inputs, a region that arises from the intercalated cells masses, and is thought to be responsible for mediating inhibition of amygdala output during extinction of conditioned fear (Likhtik et al, 2008)”] and suggest that individuals with the protective C-alleles may be slightly more able to uncouple eating from a very real and debilitating fear response.

*photo credit

Read Full Post »

Your son’s future in 27 words and 2 genotypes

Posted in 5HTT, Amygdala, TPH2, tagged , , on January 30, 2011| Leave a Comment »

Dear Mrs. Jones,

The genetic profiling results show that your son carries 2 copies of the so-called “short” allele at the serotonin transporter linked polymorphic region (5-HTTLPR) and also 2 copies of the T allele of the G-703T polymorphism (rs4570625) in the tryptophan hydroxylase-2 (TPH2) gene.

Some studies find correlations between this genotype and higher amygdala activity – which, in turn – has been correlated with a number of anxiety-related traits and disorders.

In short, you may wish to expect that your son may grow up to be slightly more shy, bashful, diffident, inhibited, reticent, shrinking, hesitant, timid, apprehensive, nervous, wary, demure, coy, blushing, self-effacing, apprehensive, fearful, faint-hearted, wimpish, mousy, lily-livered, weak-kneed, unsure & doubtful.

Congratulations!  He will be a handful to raise as a child but one day make a great scientist, and an even better science blogger.


* thanks fyns for the pic.

Read Full Post »

Some 40 million-year-old ancestors have all the luck

Posted in 5HTT, Amygdala, Frontal cortex, tagged , , , , , , , , , , on August 30, 2010| Leave a Comment »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Genetic road signs for super-size coffee SUV drivers

Posted in ADORA2A, DRD2, Uncategorized, tagged , , , , , , , , , , , , , , , , , on March 4, 2010| Leave a Comment »

If you’re a coffee drinker, you may have noticed the new super-sized portions available at Starbucks.  On this note, it may be worth noting that caffeine is a potent psychoactive substance of which – too much – can turn your buzz into a full-blown panic disorder.  The Diagnostic and Statistical Manual for psychiatry outlines a number of caffeine-related conditions mostly involving anxieties that can arise when the natural alertness-promoting effects are pushed to extremes.  Some researchers have begun to explore the way the genome interacts with caffeine and it is likely that many genetic markers will surface to explain some of the individual differences in caffeine tolerance.

Here’s a great paper, “Association between ADORA2A and DRD2 Polymorphisms and Caffeine-Induced Anxiety” [doi: 10.1038/npp.2008.17] wherein polymorphisms in the adenosine A2A receptor (ADORA2A encodes the protein that caffeine binds to and antagonizes) – as well as the dopamine D2 receptor (DRD2 encodes a protein whose downstream signals are normally counteracted by A2A receptors) — show associations with anxiety after the consumption of 150mg of caffeine (about an average cup of coffee – much less than the super-size, super-rich cups that Starbucks sells).  The variants, rs5751876 (T-allele), rs2298383 (T-allele) and rs4822492 (G-allele) from the ADORA2A gene as well as rs1110976 (-/G genotype) from the DRD2 gene showed significant increases in anxiety in a test population of 102 otherwise-healthy light-moderate regular coffee drinkers.

My own 23andMe data only provides a drop of information suggesting I’m protected from the anxiety-promoting effects.  Nevertheless, I’ll avoid the super-sizes.
rs5751876 (T-allele)  C/C – less anxiety
rs2298383 (T-allele) – not covered
rs4822492 (G-allele) – not covered
rs1110976 (-/G genotype) – not covered

Reblog this post [with Zemanta]

Read Full Post »

Epigenetics and cognitive development – quick sketch overview

Posted in BDNF, MECP2, tagged , , , , , , , , , , , , , , , on December 16, 2009| 2 Comments »

Some quick sketches that might help put the fast-growing epigenetics and cognitive development literature into context.  Visit the University of Utah’s Epigenetics training site for more background!

The genome is just the A,G,T,C bases that encode proteins and other mRNA molecules.  The “epi”genome are various modification to the DNA – such as methylation (at C residues) – and acetylation of histone proteins.   These changes help the DNA form various secondary and tertiary structures that can facilitate or block the interaction of DNA with the transcriptional machinery.

When DNA is highly methylated, it generally is less accessible for transcription and hence gene expression is reduced.  When histone proteins (purple blobs that help DNA coil into a compact shape) are acetylated, the DNA is much more accessible and gene expression goes up.

We know that proper epigenetic regulation is critical for cognitive development because mutations in MeCP2 – a protein that binds to methylated C residues – leads to Rett syndrome.  MeCP2 is normally responsible for binding to methylated DNA and recruiting histone de-acetylases (HDACs) to help DNA coil and condense into a closed form that is inaccessible for gene expression (related post here).

When DNA is accessible for gene expression, then it appears that – during brain development – there are relatively more synaptic spines produced (related post here).  Is this a good thing? Rett syndrome would suggest that – NO – too many synaptic spines and too much excitatory activity during brain development may not be optimal.  Neither is too little excitatory (too much inhibitory) activity and too few synaptic spines.  It is likely that you need just the right balance (related post here). Some have argued (here) that autism & schizophrenia are consequences of too many & too few synapses during development.

The sketch above illustrates a theoretical conjecture – not a scenario that has been verified by extensive scientific study. It tries to explain why epigenetic effects can, in practice, be difficult to disentangle from true (changes in the A,G,T,C sequence) genetic effects.  This is because – for one reason – a mother’s experience (extreme stress, malnutrition, chemical toxins) can – based on some evidence – exert an effect on the methylation of her child’s genome.  Keep in mind, that methylation is normal and widespread throughout the genome during development.  However, in this scenario, if the daughter’s behavior or physiology were to be influenced by such methylation, then she could, in theory, when reaching reproductive age, expose her developing child to an environment that leads to altered methylation (shown here of the grandaughter’s genome).  Thus, an epigenetic change would look much like there is a genetic variant being passed from one generation to the next, but such a genetic variant need not exist (related post here, here) – as its an epigenetic phenomenon.  Genes such as BDNF have been the focus of many genetic/epigenetic studies (here, here) – however, much, much more work remains to determine and understand just how much stress/malnutrition/toxin exposure is enough to cause such multi-generational effects.  Disentangling the interaction of genetics with the environment (and its influence on the epigenome) is a complex task, and it is very difficult to prove the conjecture/model above, so be sure to read the literature and popular press on these topics carefully.

Reblog this post [with Zemanta]

Read Full Post »

From the insula, rs4606 pulls a common thread back through developmental space and time

Posted in Amygdala, Insula, RGS2, tagged , , on July 7, 2009| 1 Comment »

old class photo with grandpa, 1923
Image by freeparking via Flickr

Back in the day, when the fam would get together at my parents’ house, I would enjoy shuffling through their box of old photos.  Looking at childhood pictures of myself and relatives, it was natural to compare our adult selves to the old pictures and look for similarities – emotional expressions, gestures, etc. – that have carried on through the years and are (were) a part of who we are (became) today.  It’s always amazing what you think you can see, and if you’re like me, you may be somewhat amazed by how much of your adult self was already in full swing as a child.  The manner in which the developing brain confers such stability over time and over generations (now I see my own childhood traits in my son – yikes!) is of course a timeworn question among families and scientists alike.

That the genome would contribute to cross generational parent-child similarities in personality and temperament is fairly obvious, but not so apparent is how the genome interacts with the environment to exert an influence on psychological development.  Along this line of inquiry, a research article entitled, “Influence of RGS2 on anxiety-related temperament, personality, and brain function” by Smoller and colleagues [free access] provides an amazing perspective – from a single gene.  RGS2, eponymously named as a regulator of G-protein signaling, was first identified as a factor that regulates emotional behavior in mice [PMID] and subsequently as a risk factor for schizophrenia [PMID] as well as anxiety disorders in humans [PMID].  In the current study, the team examined the temperament of children (119 families), personality of adults (744 undergraduates) and brain activity in adults (55 participants) to ascertain whether the adult risk for anxiety conferred by RGS2 might be related to actions of the gene that occur much earlier in development – such as on the systems that regulate temperament in children.  Specifically, they focused on behavioral inhibition in children (shy, avoidant, restrained in novel situations) and introversion in adults – as these traits have been associated with increased risk for anxiety disorders.

What is so interesting to me is that RGS2 (particularly the G allele of the 3’UTR SNP rs4606) was found to be associated with both childhood temperament and adult personality.  Thus, an introverted adult who looks through an old photo album and sees themselves to have been a shy or inhibited child, may be experiencing – to a small degree – the effects of the RGS2 gene.  The team suggests, via additional brain imaging-genetic studies, that RGS2 is of particular relevance to activity in circuits containing the insular cortex and amygdala – when subjects perform an emotional face matching task.

My own 23andme record does not contain the rs4606 SNP but does contain the data for rs1819741 where a T allele was significantly associated with introversion.  Since I’m a C/T heterozygote, I guess I’ll have to look a bit harder at my old pictures to see signs of behavioral inhibition.

Reblog this post [with Zemanta]

Read Full Post »

My child carries genetic risk for mental illness. Now what do I do?

Posted in Uncategorized, tagged , , , , on April 13, 2009| 1 Comment »

Genetic Data
Image by giumaiolini via Flickr

As the personal genomics era dawns, it becomes clear that the new genetic information will lead to more new questions than answers.  Consider a well-intentioned parent who finds any number of suspicious risk factors in the genome of their child.  Perhaps a genetic risk variant for mental illness – an anxiety disorder perhaps?  What can be done?  What, if anything, should be done?

Of course there is no simple answer to this question.  Nevertheless, the technology itself may create strong demand for answers in the near future.  If it were me, I certainly would want to know – something, anything – to help.  Furthermore, there are already examples of willful misinformation in the consumer genetic marketplace that seem to prey on anxieties of parents, and which could ultimately heighten the need for reliable, evidence-based guidance.

To this end, the recent research article entitled, “A Genetically Informed Study of the Association Between Childhood Separation Anxiety, Sensitivity to CO2, Panic Disorder, and the Effect of Childhood Parental Loss“[Arch Gen Psychiatry. 2009;66(1):64-71], caught my attention. In this article, the authors consider Panic Disorder, a condition which can lead to the disruption of a healthy personal and professional life.  Genetic studies have shown that specific genes can contribute to the risk of the disorder, but also that these genes interact with early life and adult life experience.  What might these genes be doing in early life – and if we knew – then might we intervene early on to prevent the onset of the disorder later in life?

Again, there are more questions than answers here, but the research team of Battaglia et al., show – using 712 young adult twins – that a common genetic factor underlies childhood separation anxiety and the adult onset of panic disorder.  Thus, it may be the case that the sames genes that contribute to the risk of panic disorder, also may contribute to a form of childhood anxiety.  Having found evidence for a particular form of developmental continuity, the research team is one step closer to learning how a genomically-guided child-based early intervention might be structured.

Because there are many pathways that can lead to mental illness and many ways in which the genome interacts with the environment – it will be complex, if not impossible, to design early interventions that prevent the onset of mental illness.  In most cases, it is rather likely that most children who carry risk for mental illness, will – due to the probablistic nature of gene-gene and gene-environment interactions – just develop typically and not develop mental illness.  Neverthess, some will and its worth learning more.

Reblog this post [with Zemanta]

Read Full Post »