Feeds:
Posts
Comments

Posts Tagged ‘Mental health’

BeFunky_OldPhoto_12

Have you ever read the DSM and thought you had EVERYTHING? Me too.

And that, sort of,  has always been a big problem … that it is really hard to separate the normal experience of anguish and suffering as part of our everyday mental and emotional lives from what is labelled a “disorder”. At the same time, however, patients, doctors and payors need some type of common reference so as to keep the diagnosis and treatment of mental suffering in-line with the way other medical illnesses are handled. So, everyone (in psychiatry, at least) knows the DSM will always be highly flawed and yet also highly necessary … so, you know, just try and live with it … but don’t expect, for a moment, to search for and find discrete genetic variants that correspond to DSM categories of mental disorders. No … because the DSM categories do not correspond well to the underlying biology of the CNS … the DSM does not “cut nature at its joints” so to speak.

Russ Poldrack provides a glimpse into what the future of diagnosing mental illness might look like using slightly more objective, quantifiable and biologically relevant measures of the brain’s physiological processes.

Also, I stumbled onto an awesome read about the creation of DSM-5 entitled, The Book of Woe

The overall thrust of the manual [DSM-5], the BPS complained, was to identify the source of psychological suffering “as located within individuals” rather than in their “relational context,” and to overlook the “undeniable social causation of many such problems.”  The APA could hardly deny any of this. As Regier had told the consumer groups on the conference call, the manual’s new organizational structure was designed to reflect “what we’ve learned about the brain, behavior, and genetics during the past two decades.” It doesn’t get much more “within the individual” and outside the “relational context” than that. (p. 239)

“Dereification is just as dumb as reinfication,” he [Allen Frances] told me. “A construct is just a construct – not to be worshiped and not to be denigrated.” Psychiatry, he was saying, has to live in the tension between the desire for certainty about the nature of our suffering and the impossibility of understanding it (or ourselves) completely. A DSM that tries to end this tension by turning itself into a living document was bound to collapse into chaos; that was the cardinal error of the incompetent DSM-5 regime. (p. 279)

“What [Dr. Thomas] Insel [Director of NIMH] heard “over and over again” on his tour was that psychiatrists were tired of being trapped by the DSM. “We are so embedded in this structure,” he told me. He and his colleagues had spent so much time diagnosing mental disorders that “we actually believe they are real. But there’s no reality. These are just constructs. There’s no reality to schizophrenia and depression.” Indeed, Insel said, “we might have to stop using terms like depression and schizophrenia, because they are getting in our way, confusing things.” Thirty years after Spitzer burned down DSM-II and built the DSM-III in its ashes, psychiatry might once again have to “just sort of start over.”” (p.340)

Yikes! after reading The Book of Woe, DSM-5 sounds, um, totally wack … if not a tool flagrantly designed to further commodify human suffering for the benefit of a medico-industrial complex. NIMH Director Thomas Insel’s recent announcement that, “NIMH will be re-orienting its research away from DSM categories.” suggests a future where diagnosis will based on biological measures and treatments are directed toward specific circuits.

Treatment for specific circuit dynamics sounds very promising. However, I thought Dr. Allen Frances, as quoted in The Book of Woe made a great point (p.346) that, “The trick is to develop a healing relationship, to care for the person not just the disorder, to diagnose and treat cautiously, and to see the healthy part of the person not just the sick.”

* Maybe that is the hope of this blog also … to take out and explore the intricate biological & molecular parts … but also to try and place them back into their original evolutionary, living, breathing, copulating (or more often the case of just thinking about copulating) “whole” human being.

Read Full Post »

A LOT of genetic data is out there … and more coming all the time … easy to get excited about, but hard to make sense of.  Here’s an epic story of just one SNP.

One of the best research teams in the business performed a genomewide association study (GWAS) of neuroticism in 1,227 US Caucasion participants and found associations (P values of 10−5 to 10−6) with several markers – including rs7151262 in the MAMDC1 gene.  Later they replicated the finding in a German sample of 1,880 (P values in the same directions 0.006–0.025).

Very exciting to ponder the ways in which this SNP might relate to the development of brain systems that process emotional information!

More recently, they attempted another replication of the MAMDC1 gene for association with neuroticism in 2,722 US Caucasion participants.  This time they report, “the current analysis failed to detect a significant association signal“.

Some 5,829 people were involved in the research and the data suggest that rs7151262 may or may not contribute to one’s neurotic tendencies.  If you knew your rs7151262 genotype would it change the way you think about yourself?

I don’t know … the confusion over the (+) vs. (-) association data would make me … well, neurotic.

thanks for the photo jinxmesomethingcrazy.

Enhanced by Zemanta

Read Full Post »

My computer desk on December 28, 2005
Image by Paladin27 via Flickr

Pointer to …50 Resources for Students Attending Online Health Psychology Schools” @ Online Schools .org which lists this blog as a resource.  From this site:

Health psychology news and information allows online students and professionals to understand the goings on in the health industry. The information makes it possible for one to learn what steps are being taken to provide better mental health care, what is going on in psychology health research, treatment and medicine.

Hope the blog will be useful.  More (and more frequent) posts to come!

 

Enhanced by Zemanta

Read Full Post »

Raging River, Preston WA
Image by Preconscious Eye via Flickr

As a parent, there are times when I realize that the world of my children is not the world I grew up in.  Yes, the Readin’, ‘Ritin’ & ‘Ritmetic are still just as important … and there is nothing as precious as apple pie and little league in the spring … and yes, kids must eat their vegetables and say their prayers at night.  Just as its always been – and will always be.  The wider technological and economic world of my children, however, is much different – most obviously altered by the recent rise of computer technology that “creatively destroys” all forms of industrial activity (media, finance, trade, healthcare) across the globe.  Such change, while unsettling, is, itself, nothing new.  Just teach the children to adapt and, like every generation before, your children will be fine.  OK.

With this in mind, I enjoyed the recent NY Times article, “Outdoors and Out of Reach, Studying the Brain” that describes a rafting expedition of neuroscientists who ventured down a remote river in Utah – purposefully out of touch with computer technology – in order to ponder how computer technology, in the form of our email, video gaming, texting etc., etc. shape our mental experience and mental health.  According to the article:

It was a primitive trip with a sophisticated goal: to understand how heavy use of digital devices and other technology changes how we think and behave, and how a retreat into nature might reverse those effects.

In particular, the team was focused on the neural systems that help us pay attention.

David Strayer, a psychology professor at the University of Utah, says that studying what happens when we step away from our devices and rest our brains — in particular, how attention, memory and learning are affected — is important science.  “Attention is the holy grail,” Mr. Strayer says.”  “Everything that you’re conscious of, everything you let in, everything you remember and you forget, depends on it.

Every parent knows that kids are increasingly hooked on this and that computer device.  We know that these devices constantly serve up all manner of entertaining news, sports scores, gossip, visual images, games, etc. etc.    Unfortunately, we also know that so-called “intermittent reinforcement”, “variable ratio of reinforcement” or “random reinforcement” can be just as addictive as any drug (the red line in the chart here shows how much more reinforcing “random” rewards are than fixed, predictable rewards).  This is why these devices are – in every sense of the word – ADDICTIVE.  They offer up a steady, but unpredictably so, stream of rewarding images and bits of information.  I mean, how many times a day do you check your email and favorite websites?  Do you feel disappointed when there is nothing juicy – but can’t help checking “just one more time”?

Hence, computer technology presents a quandary for all of us – grown ups and kids alike.  How to adapt to, and manage this “new normal” of hand-held, computer-based, ubiquitous access to social and entertainment information?

Although the trip did not yield THE definitive answer, it seemed to prompt the scientists to take a closer look at the effects and value of conecting/disconnecting from computer technology.  For Professor Todd Braver, a neuroscientist from Washington University:

When he gets back to St. Louis, he says, he plans to focus more on understanding what happens to the brain as it rests. He wants to use imaging technology to see whether the effect of nature on the brain can be measured and whether there are other ways to reproduce it, say, through meditation.

Boy, it sure would be nice to head out with the kids and shoot the rapids for a few days every time I felt overloaded!  Unfortunately NOT one our our family’s economic realities!

Professor Braver’s comments on reproducing the effect of the rafting trip through meditation, however, got me wondering, and also reminded me of a quote that is painted on the wall of my yoga shala – from the 13th century Persian poet, Rumi.

“When you do things from your soul, you feel a river moving in you, a joy”

Although I can’t get away with the kids for a rafting trip, I can – and do – enjoy spending time together in a place where “CrackBerrys” and all other forms of digital technology are not to be found.  A quiet spot in NJ near the, ahem, scenic Rahway River.  One thing my kids have been learning in their children’s yoga classes are the rudiments of mindfulness meditation.  Might this be what Professor Braver had in mind?  Can it help reproduce the cognitive and emotional effects of a river rafting trip?  As noted in the article:

Mr. Strayer, the trip leader, argues that nature can refresh the brain. “Our senses change. They kind of recalibrate — you notice sounds, like these crickets chirping; you hear the river, the sounds, the smells, you become more connected to the physical environment, the earth, rather than the artificial environment.”  … “There’s a real mental freedom in knowing no one or nothing can interrupt you,” Mr. Braver says. He echoes the others in noting that the trip is in many ways more effective than work retreats set in hotels, often involving hundreds of people who shuffle through quick meetings, wielding BlackBerrys.”

Hmmm, this kind of stuff is oft said about meditation.  As many parents fret about their way kids become attached to their digital devices, it is perhaps too early to know whether meditation is an effective counter-balance to the new digital reality.  Can it provide the same cognitive and emotional benefits experienced by the river rafters who were truly “disconnected” for a few days?  Perhaps – with practice, and more practice.  Nevertheless, a relaxing walk through the forest is different for kids today – as their digital devices buzz away in their pockets.  What’s a modern-age kid to do?

To begin to explore this question further, check out these 2 review articles on the physiological and psychological benefits of both meditation and yoga in children.  The first, Sitting-Meditation Interventions Among Youth: A Review of Treatment Efficacy by David S. Black, Joel Milam and Steve Sussman, published in Pediatrics Aug 24, 2009  and Therapeutic Effects of Yoga for Children: A Systematic Review of the Literature by doctors Mary Lou Galantino, Robyn Galbavy and Lauren Quinn from the University of Pennsylvania.

Both articles examine existing scientific evidence – in the form of controlled clinical studies – on whether these very ancient practices provide benefits to kids in the modern world.  In short – they do – but more research is needed to better understand how much benefit is provided.  How many sessions are needed?  Does it last after practicing stops?  How do the benefits work?  How to best engage children of different ages?  From the abstracts:

“Sitting meditation seems to be an effective intervention in the treatment of physiologic, psychosocial, and behavioral conditions among youth.” … “The evidence shows physiological benefits of yoga for the pediatric population that may benefit children through the rehabilitation process, but larger clinical trials, including specific measures of quality of life are necessary to provide definitive evidence.”

Its fun to meditate and fun to spend quiet time with my young children – so there is no real downside to spending some time meditating and “disconnecting” from our digital devices.  Might they be learning a skill that protects their creativity and emotional well-being?  I hope so.  Perhaps one day when they are older, they will email me to let me know!

To learn more about meditation for children, visit The David Lynch FoundationUCLA Mindful Awareness Research Center (adapting ancient practices to modern life),  the Committee for Stress-Free Schools, Dr. Elizabeth Reid’s six week curriculum to encourage mindful learning in a class of fourth grade students and an interview with my former postdoctoral mentor on the science of attention training.

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Corticotropin-releasing hormone
Image via Wikipedia

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension”  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar

Reblog this post [with Zemanta]

Read Full Post »

Twin studies have long suggested that genetic variation is a part of healthy and disordered mental life.  The problem however – some 10 years now since the full genome sequence era began – has been finding the actual genes that account for this heritability.

It sounds simple on paper – just collect lots of folks with disorder X and look at their genomes in reference to a demographically matched healthy control population.  Voila! whatever is different is a candidate for genetic risk.  Apparently, not so.

The missing heritability problem that clouds the birth of the personal genomes era refers to the baffling inability to find enough common genetic variants that can account for the genetic risk of an illness or disorder.

There are any number of reasons for this … (i) even as any given MZ and DZ twin pair shares genetic variants that predispose them toward the similar brains and mental states, it may be the case that different MZ and DZ pairs have different types of rare genetic variation thus diluting out any similar patterns of variation when large pools of cases and controls are compared …  (ii) also, the way that the environment interacts with common risk-promoting genetic variation may be quite different from person to person – making it hard to find variation that is similarly risk-promoting in large pools of cases and controls … and many others I’m sure.

One research group recently asked whether the type of common genetic variation(SNP vs. CNV) might inform the search for the missing heritability.  The authors of the recent paper, “Genome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls” [doi:10.1038/nature08979] looked at an alternative to the usual SNP markers – so called common copy number variants (CNVs) – and asked if these markers might provide a stronger accounting for genetic risk.  While a number of previous papers in the mental health field have indeed shown associations with CNVs, this massive study (some 3,432 CNV probes in 2000 or so cases and 3000 controls) did not reveal an association with bipolar disorder.  Furthermore, the team reports that common CNV variants are already in fairly strong linkage disequilibrium with common SNPs and so perhaps may not have reached any farther into the abyss of rare genetic variation than previous GWAS studies.

Disappointing perhaps, but a big step forward nonetheless!  What will the personal genomes era look like if we all have different forms of rare genetic variation?

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »