Feeds:
Posts
Comments

Posts Tagged ‘Mental health’

BeFunky_OldPhoto_12

Have you ever read the DSM and thought you had EVERYTHING? Me too.

And that, sort of,  has always been a big problem … that it is really hard to separate the normal experience of anguish and suffering as part of our everyday mental and emotional lives from what is labelled a “disorder”. At the same time, however, patients, doctors and payors need some type of common reference so as to keep the diagnosis and treatment of mental suffering in-line with the way other medical illnesses are handled. So, everyone (in psychiatry, at least) knows the DSM will always be highly flawed and yet also highly necessary … so, you know, just try and live with it … but don’t expect, for a moment, to search for and find discrete genetic variants that correspond to DSM categories of mental disorders. No … because the DSM categories do not correspond well to the underlying biology of the CNS … the DSM does not “cut nature at its joints” so to speak.

Russ Poldrack provides a glimpse into what the future of diagnosing mental illness might look like using slightly more objective, quantifiable and biologically relevant measures of the brain’s physiological processes.

Also, I stumbled onto an awesome read about the creation of DSM-5 entitled, The Book of Woe

The overall thrust of the manual [DSM-5], the BPS complained, was to identify the source of psychological suffering “as located within individuals” rather than in their “relational context,” and to overlook the “undeniable social causation of many such problems.”  The APA could hardly deny any of this. As Regier had told the consumer groups on the conference call, the manual’s new organizational structure was designed to reflect “what we’ve learned about the brain, behavior, and genetics during the past two decades.” It doesn’t get much more “within the individual” and outside the “relational context” than that. (p. 239)

“Dereification is just as dumb as reinfication,” he [Allen Frances] told me. “A construct is just a construct – not to be worshiped and not to be denigrated.” Psychiatry, he was saying, has to live in the tension between the desire for certainty about the nature of our suffering and the impossibility of understanding it (or ourselves) completely. A DSM that tries to end this tension by turning itself into a living document was bound to collapse into chaos; that was the cardinal error of the incompetent DSM-5 regime. (p. 279)

“What [Dr. Thomas] Insel [Director of NIMH] heard “over and over again” on his tour was that psychiatrists were tired of being trapped by the DSM. “We are so embedded in this structure,” he told me. He and his colleagues had spent so much time diagnosing mental disorders that “we actually believe they are real. But there’s no reality. These are just constructs. There’s no reality to schizophrenia and depression.” Indeed, Insel said, “we might have to stop using terms like depression and schizophrenia, because they are getting in our way, confusing things.” Thirty years after Spitzer burned down DSM-II and built the DSM-III in its ashes, psychiatry might once again have to “just sort of start over.”” (p.340)

Yikes! after reading The Book of Woe, DSM-5 sounds, um, totally wack … if not a tool flagrantly designed to further commodify human suffering for the benefit of a medico-industrial complex. NIMH Director Thomas Insel’s recent announcement that, “NIMH will be re-orienting its research away from DSM categories.” suggests a future where diagnosis will based on biological measures and treatments are directed toward specific circuits.

Treatment for specific circuit dynamics sounds very promising. However, I thought Dr. Allen Frances, as quoted in The Book of Woe made a great point (p.346) that, “The trick is to develop a healing relationship, to care for the person not just the disorder, to diagnose and treat cautiously, and to see the healthy part of the person not just the sick.”

* Maybe that is the hope of this blog also … to take out and explore the intricate biological & molecular parts … but also to try and place them back into their original evolutionary, living, breathing, copulating (or more often the case of just thinking about copulating) “whole” human being.

Read Full Post »

A LOT of genetic data is out there … and more coming all the time … easy to get excited about, but hard to make sense of.  Here’s an epic story of just one SNP.

One of the best research teams in the business performed a genomewide association study (GWAS) of neuroticism in 1,227 US Caucasion participants and found associations (P values of 10−5 to 10−6) with several markers – including rs7151262 in the MAMDC1 gene.  Later they replicated the finding in a German sample of 1,880 (P values in the same directions 0.006–0.025).

Very exciting to ponder the ways in which this SNP might relate to the development of brain systems that process emotional information!

More recently, they attempted another replication of the MAMDC1 gene for association with neuroticism in 2,722 US Caucasion participants.  This time they report, “the current analysis failed to detect a significant association signal“.

Some 5,829 people were involved in the research and the data suggest that rs7151262 may or may not contribute to one’s neurotic tendencies.  If you knew your rs7151262 genotype would it change the way you think about yourself?

I don’t know … the confusion over the (+) vs. (-) association data would make me … well, neurotic.

thanks for the photo jinxmesomethingcrazy.

Enhanced by Zemanta

Read Full Post »

My computer desk on December 28, 2005
Image by Paladin27 via Flickr

Pointer to … “50 Resources for Students Attending Online Health Psychology Schools” @ Online Schools .org which lists this blog as a resource.  From this site:

Health psychology news and information allows online students and professionals to understand the goings on in the health industry. The information makes it possible for one to learn what steps are being taken to provide better mental health care, what is going on in psychology health research, treatment and medicine.

Hope the blog will be useful.  More (and more frequent) posts to come!

 

Enhanced by Zemanta

Read Full Post »

Raging River, Preston WA
Image by Preconscious Eye via Flickr

As a parent, there are times when I realize that the world of my children is not the world I grew up in.  Yes, the Readin’, ‘Ritin’ & ‘Ritmetic are still just as important … and there is nothing as precious as apple pie and little league in the spring … and yes, kids must eat their vegetables and say their prayers at night.  Just as its always been – and will always be.  The wider technological and economic world of my children, however, is much different – most obviously altered by the recent rise of computer technology that “creatively destroys” all forms of industrial activity (media, finance, trade, healthcare) across the globe.  Such change, while unsettling, is, itself, nothing new.  Just teach the children to adapt and, like every generation before, your children will be fine.  OK.

With this in mind, I enjoyed the recent NY Times article, “Outdoors and Out of Reach, Studying the Brain” that describes a rafting expedition of neuroscientists who ventured down a remote river in Utah – purposefully out of touch with computer technology – in order to ponder how computer technology, in the form of our email, video gaming, texting etc., etc. shape our mental experience and mental health.  According to the article:

It was a primitive trip with a sophisticated goal: to understand how heavy use of digital devices and other technology changes how we think and behave, and how a retreat into nature might reverse those effects.

In particular, the team was focused on the neural systems that help us pay attention.

David Strayer, a psychology professor at the University of Utah, says that studying what happens when we step away from our devices and rest our brains — in particular, how attention, memory and learning are affected — is important science.  “Attention is the holy grail,” Mr. Strayer says.”  “Everything that you’re conscious of, everything you let in, everything you remember and you forget, depends on it.

Every parent knows that kids are increasingly hooked on this and that computer device.  We know that these devices constantly serve up all manner of entertaining news, sports scores, gossip, visual images, games, etc. etc.    Unfortunately, we also know that so-called “intermittent reinforcement”, “variable ratio of reinforcement” or “random reinforcement” can be just as addictive as any drug (the red line in the chart here shows how much more reinforcing “random” rewards are than fixed, predictable rewards).  This is why these devices are – in every sense of the word – ADDICTIVE.  They offer up a steady, but unpredictably so, stream of rewarding images and bits of information.  I mean, how many times a day do you check your email and favorite websites?  Do you feel disappointed when there is nothing juicy – but can’t help checking “just one more time”?

Hence, computer technology presents a quandary for all of us – grown ups and kids alike.  How to adapt to, and manage this “new normal” of hand-held, computer-based, ubiquitous access to social and entertainment information?

Although the trip did not yield THE definitive answer, it seemed to prompt the scientists to take a closer look at the effects and value of conecting/disconnecting from computer technology.  For Professor Todd Braver, a neuroscientist from Washington University:

When he gets back to St. Louis, he says, he plans to focus more on understanding what happens to the brain as it rests. He wants to use imaging technology to see whether the effect of nature on the brain can be measured and whether there are other ways to reproduce it, say, through meditation.

Boy, it sure would be nice to head out with the kids and shoot the rapids for a few days every time I felt overloaded!  Unfortunately NOT one our our family’s economic realities!

Professor Braver’s comments on reproducing the effect of the rafting trip through meditation, however, got me wondering, and also reminded me of a quote that is painted on the wall of my yoga shala – from the 13th century Persian poet, Rumi.

“When you do things from your soul, you feel a river moving in you, a joy”

Although I can’t get away with the kids for a rafting trip, I can – and do – enjoy spending time together in a place where “CrackBerrys” and all other forms of digital technology are not to be found.  A quiet spot in NJ near the, ahem, scenic Rahway River.  One thing my kids have been learning in their children’s yoga classes are the rudiments of mindfulness meditation.  Might this be what Professor Braver had in mind?  Can it help reproduce the cognitive and emotional effects of a river rafting trip?  As noted in the article:

Mr. Strayer, the trip leader, argues that nature can refresh the brain. “Our senses change. They kind of recalibrate — you notice sounds, like these crickets chirping; you hear the river, the sounds, the smells, you become more connected to the physical environment, the earth, rather than the artificial environment.”  … “There’s a real mental freedom in knowing no one or nothing can interrupt you,” Mr. Braver says. He echoes the others in noting that the trip is in many ways more effective than work retreats set in hotels, often involving hundreds of people who shuffle through quick meetings, wielding BlackBerrys.”

Hmmm, this kind of stuff is oft said about meditation.  As many parents fret about their way kids become attached to their digital devices, it is perhaps too early to know whether meditation is an effective counter-balance to the new digital reality.  Can it provide the same cognitive and emotional benefits experienced by the river rafters who were truly “disconnected” for a few days?  Perhaps – with practice, and more practice.  Nevertheless, a relaxing walk through the forest is different for kids today – as their digital devices buzz away in their pockets.  What’s a modern-age kid to do?

To begin to explore this question further, check out these 2 review articles on the physiological and psychological benefits of both meditation and yoga in children.  The first, Sitting-Meditation Interventions Among Youth: A Review of Treatment Efficacy by David S. Black, Joel Milam and Steve Sussman, published in Pediatrics Aug 24, 2009  and Therapeutic Effects of Yoga for Children: A Systematic Review of the Literature by doctors Mary Lou Galantino, Robyn Galbavy and Lauren Quinn from the University of Pennsylvania.

Both articles examine existing scientific evidence – in the form of controlled clinical studies – on whether these very ancient practices provide benefits to kids in the modern world.  In short – they do – but more research is needed to better understand how much benefit is provided.  How many sessions are needed?  Does it last after practicing stops?  How do the benefits work?  How to best engage children of different ages?  From the abstracts:

“Sitting meditation seems to be an effective intervention in the treatment of physiologic, psychosocial, and behavioral conditions among youth.” … “The evidence shows physiological benefits of yoga for the pediatric population that may benefit children through the rehabilitation process, but larger clinical trials, including specific measures of quality of life are necessary to provide definitive evidence.”

Its fun to meditate and fun to spend quiet time with my young children – so there is no real downside to spending some time meditating and “disconnecting” from our digital devices.  Might they be learning a skill that protects their creativity and emotional well-being?  I hope so.  Perhaps one day when they are older, they will email me to let me know!

To learn more about meditation for children, visit The David Lynch Foundation,  UCLA Mindful Awareness Research Center (adapting ancient practices to modern life),  the Committee for Stress-Free Schools, Dr. Elizabeth Reid’s six week curriculum to encourage mindful learning in a class of fourth grade students and an interview with my former postdoctoral mentor on the science of attention training.

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Corticotropin-releasing hormone
Image via Wikipedia

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension”  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar

Reblog this post [with Zemanta]

Read Full Post »

Twin studies have long suggested that genetic variation is a part of healthy and disordered mental life.  The problem however – some 10 years now since the full genome sequence era began – has been finding the actual genes that account for this heritability.

It sounds simple on paper – just collect lots of folks with disorder X and look at their genomes in reference to a demographically matched healthy control population.  Voila! whatever is different is a candidate for genetic risk.  Apparently, not so.

The missing heritability problem that clouds the birth of the personal genomes era refers to the baffling inability to find enough common genetic variants that can account for the genetic risk of an illness or disorder.

There are any number of reasons for this … (i) even as any given MZ and DZ twin pair shares genetic variants that predispose them toward the similar brains and mental states, it may be the case that different MZ and DZ pairs have different types of rare genetic variation thus diluting out any similar patterns of variation when large pools of cases and controls are compared …  (ii) also, the way that the environment interacts with common risk-promoting genetic variation may be quite different from person to person – making it hard to find variation that is similarly risk-promoting in large pools of cases and controls … and many others I’m sure.

One research group recently asked whether the type of common genetic variation(SNP vs. CNV) might inform the search for the missing heritability.  The authors of the recent paper, “Genome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls” [doi:10.1038/nature08979] looked at an alternative to the usual SNP markers – so called common copy number variants (CNVs) – and asked if these markers might provide a stronger accounting for genetic risk.  While a number of previous papers in the mental health field have indeed shown associations with CNVs, this massive study (some 3,432 CNV probes in 2000 or so cases and 3000 controls) did not reveal an association with bipolar disorder.  Furthermore, the team reports that common CNV variants are already in fairly strong linkage disequilibrium with common SNPs and so perhaps may not have reached any farther into the abyss of rare genetic variation than previous GWAS studies.

Disappointing perhaps, but a big step forward nonetheless!  What will the personal genomes era look like if we all have different forms of rare genetic variation?

Reblog this post [with Zemanta]

Read Full Post »

A sculpture of a Hindu yogi in the Birla Mandi...
Image via Wikipedia

This past friday, I attended my first meditation session at my new yoga school.  I love this school and hope – someday – to make it through the full Ashtanga series and other sequences the instructors do.  In the meantime, I found myself sitting on my folded up blanket, letting my mind wander, listening to my breath and just trying to enjoy the moment.

What a wonderful experience it was … it felt great!  … I think I my have even given my brain a rest. A simple kindness to repay it for all it has done for me!

Although I did not know what I was supposed to be “doing” during meditation, the experience itself has me hooked and fascinated with a new research article, “Genetic control over the resting brain” [doi: 10.1073/pnas.0909969107]  by David Glahn and colleages.

Reading this paper, I learned that my brain “at rest” is really very active with neural activity in a series of interconnected circuits known as the default network.  Moreover, the research team finds that many of these interconnected circuits fire together in a way that is significantly influenced by genetic factors (overall heritability of about 0.42).  By analyzing the resting state (lay in the MRI and let your mind wander) patterns of activity in 333 folks from extended pedigrees, the team shows that certain interconnections (neural activity between 2 or more regions) within the default network are more highly correlated in people who are more related to each other.  For example, the left parahippocampal region was genetically correlated with many of the other brain areas in the default network.

Of course, these genetic effects on resting state connectivity are far from determinative, and the authors noted that some interconnections within the default network were more sensitive to environmental factors – such as functional connectivity between right temporal-parietal & posterior cingulate/precuneus & medial prefronal cortex.

Wow, so my resting state activity must – at some level – as a partial product of my genome – be rather unique and special.  It certainly felt that way as my mind wandered freely during meditation class. The authors point out that their heritability study lays more groundwork for follow-up gene hunting expeditions to isolate specific genetic variants.  This will be very exciting!

Some other items from their paper that I’ll be pondering in my next meditation class are the facts that these default neural networks are already present in the infant brain!  and in our non-human primate cousins (even when they are not conscious)!  Whoa!  These genetics & resting-state brain studies will really push our sense of what it means to be human, to be unique, to be interconnected by a common (genetic) thread from generation to generation over vast spatial and temporal distances (is this karma of sorts?).

I suppose yogis & other practitioners of meditation might be bemused at this recent avenue of “cutting edge” scientific inquiry – I mean – duh?!  of course, it makes sense that by remaining calm and sitting quietly that we would discover ourselves.

Related posts here, here, here

Reblog this post [with Zemanta]

Read Full Post »

Just a pointer to a great book – The Loss of Sadness: How Psychiatry Transformed Normal Sorrow into Depressive Disorder by Allan V. Horwitz and Jerome C. Wakefield.  Its an in-depth treatment on the many reasons and contexts in which we – quite naturally – feel sad and depressed and the way in which diagnostic criteria can distort the gray area between normal sadness and a psychiatric disorder.  I really enjoyed the developmental perspective on the natural advantages of negative emotions in childhood (a signal to attract caregivers) as well as the detailed evolution of the DSM diagnostic criteria.  The main gist of the book is that much of what psychiatrists treat as emotional disorders are more likely just the natural responses to the normal ups and downs of life – not disorders at all.  A case for American consumers as pill-popping suckers to medical-pharma-marketing overreach (here’s a related post on this overreach notion pointing to the work of David Healy).

Reading the book makes me feel liberated from the medical labels that are all too readily slapped on healthy people.  There is much that is healthy about sadness and many reasons and contexts in which its quite natural.  From now on, instead of trying to escape from, or rid myself of sadness, I will embrace it and let myself feel it and work through it.  Who knows, maybe this is a good first step in a healthy coping process.

If depressed emotional states are more a part of the normal range of emotions (rather than separate disordered states) then does this allow us to make predictions about the underlying genetic bases for these states?    Perhaps not.   However, on page 172, the authors apply their critical view to the highly cited Caspi et al., article (showing that 5HTT genotype interacts with life stress in the presentation of depressive illness – critiqued here).  They note that the incidence of depression at 17% in the sample is much too high – most certainly capturing a lot of normal sadness.  Hence, the prevalent short allele in the 5HTT promoter might be better thought of as a factor that underlies how healthy people respond to social stress – rather than as a drug target or risk factor for psychiatric illness.

Reblog this post [with Zemanta]

Read Full Post »

Crocus (cropped)
Image by noahg. via Flickr

If you’ve started to notice the arrival of spring blossoms, you may have wondered, “how do the blossoms know when its spring?”  Well, it turns out that its not the temperature, but rather, that plants sense the length of the day-light cycle in order to synchronize their  own life cycles with the seasons.  According to the photoperiodism entry for wikipedia, “Many flowering plants use a photoreceptor protein, such as phytochrome or cryptochrome, to sense seasonal changes in night length, or photoperiod, which they take as signals to flower.”

It turns out that humans are much the same. Say wha?!

Yep, as the long ago descendants of single cells who had to eek out a living during day (when the sun emits mutagenic UV radiation) and night cycles, our very own basic molecular machinery that regulates the transcription, translation, replication and a host of other cellular functions is remarkably sensitive – entrained – in a clock-like fashion to the rising and setting sun.  This is because, in our retinas, there are light-sensing cells that send signals to the suprachiasmatic nucleus (SCN) which then – via the pineal gland – secretes systemic hormones such as melatonin that help synchronize cells and organs in your brain and body.  When this process is disrupted, folks can feel downright lousy, as seen in seasonal affective disorder (SAD), delayed sleep phase syndrome (DSPS) and other circadian rhythm disorders.

If you’re skeptical, consider the effects of genetic variation in genes that regulate our circadian rhythms, often called “clock” genes – very ancient genes that keep our cellular clocks synchronized with each other and the outside environment.  Soria et al., have a great paper entitled, “Differential Association of Circadian Genes with Mood Disorders: CRY1 and NPAS2 are Associated with Unipolar Major Depression and CLOCK and VIP with Bipolar Disorder” [doi: 10.1038/npp.2009.230] wherein they reveal that normal variation in these clock genes is associated with mood regulation.

A few of the highlights reported are rs2287161 in the CRY1 gene,  rs11123857 in the NPAS2 gene, and rs885861 in the VIPR2 gene – where the C-allele, G-allele and C-allele, respectively, were associated with mood disorders.

I’m not sure how one would best interpret genetic variation of such circadian rhythm genes.  Perhaps they index how much a person’s mood could be influenced by changes or disruptions to the normal rhythm??  Not sure.  My 23andMe data shows the non-risk AA genotype for rs11123857 (the others are not covered by 23andMe).

Reblog this post [with Zemanta]

Read Full Post »

According to wikipedia, “Jean Philippe Arthur Dubuffet (July 31, 1901 – May 12, 1985) was one of the most famous French painters and sculptors of the second half of the 20th century.”  “He coined the term Art Brut (meaning “raw art,” often times referred to as ‘outsider art’) for art produced by non-professionals working outside aesthetic norms, such as art by psychiatric patients, prisoners, and children.”  From this interest, he amassed the Collection de l’Art Brut, a sizable collection of artwork, of which more than half, was painted by artists with schizophrenia.  One such painting that typifies this style is shown here, entitled, General view of the island Neveranger (1911) by Adolf Wolfe, a psychiatric patient.

Obviously, Wolfe was a gifted artist, despite whatever psychiatric diagnosis was suggested at the time.  Nevertheless, clinical psychiatrists might be quick to point out that such work reflects the presence of an underlying thought disorder (loss of abstraction ability, tangentiality, loose associations, derailment, thought blocking, overinclusive thinking, etc., etc.) – despite the undeniable aesthetic beauty in the work.  As an ardent fan of such art,  it made me wonder just how “well ordered” my own thoughts might be.  Given to being rather forgetful and distractable, I suspect my thinking process is just sufficiently well ordered to perform the routine tasks of day-to-day living, but perhaps not a whole lot more so.  Is this bad or good?  Who knows.

However, Krug et al., in their recent paper, “The effect of Neuregulin 1 on neural correlates of episodic memory encoding and retrieval” [doi:10.1016/j.neuroimage.2009.12.062] do note that the brains of unaffected relatives of persons with mental illness show subtle differences in various patterns of activation.  It seems that when individuals are using their brains to encode information for memory storage, unaffected relatives show greater activation in areas of the frontal cortex compared to unrelated subjects.  This so-called encoding process during episodic memory is very important for a healthy memory system and its dysfunction is correlated with thought disorders and other aspects of cognitive dysfunction.  Krug et al., proceed to explore this encoding process further and ask if a well-known schizophrenia risk variant (rs35753505 C vs. T) in the neuregulin-1 gene might underlie this phenomenon.  To do this, they asked 34 TT, 32 TC and 28 CC individuals to perform a memory (of faces) game whilst laying in an MRI scanner.

The team reports that there were indeed differences in brain activity during both the encoding (storage) and retrieval (recall) portions of the task – that were both correlated with genotype – and also in which the CC risk genotype was correlated with more (hyper-) activation.  Some of the brain areas that were hyperactivated during encoding and associated with CC genotype were the left middle frontal gyrus (BA 9), the bilateral fusiform gyrus and the left middle occipital gyrus (BA 19).  The left middle occipital gyrus showed gene associated-hyperactivation during recall.  So it seems, that healthy individuals can carry risk for mental illness and that their brains may actually function slightly differently.

As an ardent fan of Art Brut, I confess I hoped I would carry the CC genotype, but alas, my 23andme profile shows a boring TT genotype.  No wonder my artwork sucks.  More on NRG1 here.

Reblog this post [with Zemanta]

Read Full Post »

wotd044
Image by theloushe via Flickr

** PODCAST accompanies this post**

I have a little boy who loves to run and jump and scream and shout – a lot.  And by this, I mean running – at full speed and smashing his head into my gut,  jumping – off the couch onto my head,  screaming – spontaneous curses and R-rated body parts and bodily functions.  I hope you get the idea.  Is this normal? or (as I oft imagine) will I soon be sitting across the desk from a school psychologist pitching me the merits of an ADHD diagnosis and medication?

Of course, when it comes to behavior, there is not a distinct line one can cross from normal to abnormal.  Human behavior is complex, multi-dimensional and greatly interpreted through the lens of culture.  Our present culture is highly saturated by mass-marketing, making it easy to distort a person’s sense of “what’s normal” and create demand for consumer products that folks don’t really need (eg. psychiatric diagnoses? medications?).   Anyhow, its tough to know what’s normal.  This is an important issue to consider for those (mass-marketing hucksters?) who might be inclined to promote genetic data as “hard evidence” for illness, disorder or abnormality of some sort.

With this in mind, I really enjoyed a recent paper by Stollstorff et al., “Neural response to working memory load varies by dopamine transporter genotype in children” [doi:10.1016/j.neuroimage.2009.12.104] who asked how the brains of healthy children functioned, even though they carry a genotype that has been widely associated with the risk of ADHD.  Healthy children who carry genetic risk for ADHD. Hmm, might this be my boy?

The researchers looked at a 9- vs. 10-repeat VNTR polymorphism in the 3′-UTR of the dopamine transporter gene (DAT1).  This gene – which encodes the very protein that is targeted by so many ADHD medications – influences the re-uptake of dopamine from the synaptic cleft.  In the case of 10/10 genotypes, it seems that DAT1 is more highly expressed, thus leading to more re-uptake and hence less dopamine in the synaptic cleft.  Generally, dopamine is needed to enhance the signal/noise of neurotransmission, so – at the end of the day – the 10/10 genotype is considered less optimal than the 9/9-repeat genotype.  As noted by the researchers, the ADHD literature shows that the 10-repeat allele, not the 9-repeat, is most often associated with ADHD.

The research team asked these healthy children (typically developing children between 7 and 12 years of age) to perform a so-called N-back task which requires that children remember words that are presented to them one-at-a-time.  Each time a new word is presented, the children had to decide whether that word was the same as the previous word (1-back) or the previous, previous word (2-back).  Its a maddening task and places an extreme demand on neural circuits involved in active maintenance of information (frontal cortex) as well as inhibition of irrelevant information that occurs during updating (basal ganglia circuits).

As the DAT1 protein is widely expressed in the basal ganglia, the research team asked where in the brain was variation in the DAT1 (9- vs. 10-repeat) associated with neural activity?  and where was there a further difference between 1-back and 2-back?  Indeed, the team finds that brain activity in many regions of the basal ganglia (caudate, putamen, substantia nigra & subthalamic nucleus) were associated with genetic variation in DAT1.  Neat!  the gene may be exerting an influence on brain function (and behavior) in healthy children, even though they do not carry a diagnosis.  Certainly, genes are not destiny, even though they do influence brain and behavior.

What was cooler to me though, is the way the investigators examined the role of genetic variation in the 1-back (easy or low load condition) vs. 2-back (harder, high-load condition) tasks.  Their data shows that there was less of an effect of genotype on brain activation in the easy tasks.  Rather, only when the task was hard, did it become clear that the basal ganglia in the 10/10 carriers was lacking the necessary brain activation needed to perform the more difficult task.  Thus, the investigators reveal that the genetic risk may not be immediately apparent under conditions where heavy “loads” or demands are not placed on the brain.  Cognitive load matters when interpreting genetic data!

This result made me think that genes in the brain might be a lot like genes in muscles.  Individual differences in muscle strength are not associated with genotype when kids are lifting feathers.  Only when kids are actually training and using their muscles, might one start to see that some genetically advantaged kids have muscles that strengthen faster than others.  Does this mean there is a “weak muscle gene” – yes, perhaps.  But with the proper training regimen, children carrying such a “weak muscle gene” would be able to gain plenty of strength.

I guess its off to the mental and physical gyms for me and my son.

** PODCAST accompanies this post** also, here’s a link to the Vaidya lab!

Reblog this post [with Zemanta]

Read Full Post »

Recreated :File:Neuron-no labels2.png in Inksc...
Image via Wikipedia

The A-to-T SNP rs7794745 in the CNTNAP2 gene was found to be associated with increased risk of autism (see Arking et al., 2008).  Specifically, the TT genotype, found in about 15% of individuals, increases these folks’ risk by about 1.2-1.7-fold.  Sure enough, when I checked my 23andMe profile, I found that I’m one of these TT risk-bearing individuals.  Interesting, although not alarming since me and my kids are beyond the age where one typically worries about autism.  Still, one can wonder if such a risk factor might have exerted some influence on the development of my brain?

The recent paper by Tan et al., “Normal variation in fronto-occipital circuitry and cerebellar structure with an autism-associated polymorphism of CNTNAP2” [doi:10.1016/j.neuroimage.2010.02.018 ] suggests there may be subtle, but still profound influences of the TT genotype on brain development in healthy individuals.  According to the authors, “homozygotes for the risk allele showed significant reductions in grey and white matter volume and fractional anisotropy in several regions that have already been implicated in ASD, including the cerebellum, fusiform gyrus, occipital and frontal cortices. Male homozygotes for the risk alleles showed greater reductions in grey matter in the right frontal pole and in FA in the right rostral fronto-occipital fasciculus compared to their female counterparts who showed greater reductions in FA of the anterior thalamic radiation.”

The FA (fractional anisotropy – a measurement of white-matter or myelination) results are consistent with a role of CNTNAP2 in the establishment of synaptic contacts and other cell-cell contacts especially at Nodes of Ranvier – which are critical for proper function of white-matter tracts that support rapid, long-range neural transmission.  Indeed, more severe mutations in CNTNAP2  have been associated with cortical dysplasia and focal epilepsy (Strauss et al., 2006).

Subtle changes perhaps influencing long-range information flow in my brain – wow!

More on CNTNAP2 … its evolutionary history and role in language development.

Reblog this post [with Zemanta]

Read Full Post »

If you’re a coffee drinker, you may have noticed the new super-sized portions available at Starbucks.  On this note, it may be worth noting that caffeine is a potent psychoactive substance of which – too much – can turn your buzz into a full-blown panic disorder.  The Diagnostic and Statistical Manual for psychiatry outlines a number of caffeine-related conditions mostly involving anxieties that can arise when the natural alertness-promoting effects are pushed to extremes.  Some researchers have begun to explore the way the genome interacts with caffeine and it is likely that many genetic markers will surface to explain some of the individual differences in caffeine tolerance.

Here’s a great paper, “Association between ADORA2A and DRD2 Polymorphisms and Caffeine-Induced Anxiety” [doi: 10.1038/npp.2008.17] wherein polymorphisms in the adenosine A2A receptor (ADORA2A encodes the protein that caffeine binds to and antagonizes) – as well as the dopamine D2 receptor (DRD2 encodes a protein whose downstream signals are normally counteracted by A2A receptors) — show associations with anxiety after the consumption of 150mg of caffeine (about an average cup of coffee – much less than the super-size, super-rich cups that Starbucks sells).  The variants, rs5751876 (T-allele), rs2298383 (T-allele) and rs4822492 (G-allele) from the ADORA2A gene as well as rs1110976 (-/G genotype) from the DRD2 gene showed significant increases in anxiety in a test population of 102 otherwise-healthy light-moderate regular coffee drinkers.

My own 23andMe data only provides a drop of information suggesting I’m protected from the anxiety-promoting effects.  Nevertheless, I’ll avoid the super-sizes.
rs5751876 (T-allele)  C/C – less anxiety
rs2298383 (T-allele) – not covered
rs4822492 (G-allele) – not covered
rs1110976 (-/G genotype) – not covered

Reblog this post [with Zemanta]

Read Full Post »

OM, computer generated image - Png file, Atten...
Image by MAMJODH via Flickr

Oxygen is the key to life.  This is because it loves electrons.  In the mitochondria of every cell in your body, oxygen (in is atmospheric O2 state) serves as the ultimate electron acceptor and provides the chemical energy that drives the formation of ATP (a form of chemical energy storage that our body uses for all its cellular functions).

Oxygen is the key to death.  This is because it loves electrons.  When so-called reactive oxygen species (small molecules that contain oxygen in an ionized form) are permitted to roam free in cell and the body, they can indiscriminately pull electrons from other molecules (oxidation) and cause undesirable protein damage and premature cell death.

There is no escaping this chemical reality.  The very substance that giveth life, doth take it away and our longevity teeters on the quantum mechanical balance of electrons whizzing around the nucleus of the oxygen atom.  (I’ll think about this and the chemical symbol for oxygen (O), next time I chant “Om” in yoga class).

So it is with this humbling knowledge that many search for ways to optimize this balance (several populations have already figured out how to routinely live to 100+ years!) or at least improve the quality of our naturally limited life-span.  Light exercise, vegetables, friends and not too much alcohol.

Consider the recent paper, by Srivastava et al., “Association of SOD2, a Mitochondrial Antioxidant Enzyme, with Gray Matter Volume Shrinkage in Alcoholics” [doi: 10.1038/npp.2009.217].  The authors report that shrinkage of the neocortex (gray matter) of the brain is associated  chronic high levels of alcohol consumption.  That’s right, too much alcohol shrinks your brain.  Yikes!  How does alcohol exert its effect on brain shrinkage?  Well,  the authors measured many aspects of liver function (various enzyme levels), but these did not correlate with gray matter shrinkage.  Rather, the authors traced the effect to an enzyme that normally keeps harmful reactive oxygen species at bay – the so-called superoxide dismutase (SOD) enzyme.  We all have this enzyme, but in some of us, those who carry the rs4880 “G” allele of our SOD2 gene produce an enzyme that has an alanine at position 16 (Ala16) and is less active than the rs4880 “A” allele which encodes a more active enzyme with a Valine at position 16 (Val16).  The authors report that the rs10370 “TT”, rs4880 “GG” diplo-genotype (diplotype) was associated with more gray matter shrinkage in 76 individuals who report chronic high levels of alcohol consumption.  Here, the less active form of SOD2 is seemingly less able to metabolize all the harmful superoxide radicals that are generated during chronic exposure to alcohol.  Apparently their neurons are in retreat.

Reblog this post [with Zemanta]

Read Full Post »

Church Steeple
Image by muffintoptn via Flickr

Humans are spiritual creatures – there’s no denyin’.  How & why we got this way is one of THE BIG questions of all time.  Since our genome shapes the development of our brain and its interaction with our culture, its not a surprise to see that, from time to time, folks will look for and find genetic links to various forms of spiritual and religious behavior.  Here’s a recent paper from Kenneth Kendler’s research team at the Virginia Institute for Psychiatric and Behavioral Genetics, Virginia Commonwealth University School of Medicine entitled, “A Developmental Twin Study of Church Attendance and Alcohol and Nicotine Consumption: A Model for Analyzing the Changing Impact of Genes and Environment” [link to abstract].  An analysis of more than 700 pairs of twins found that the correlation between alcohol and nicotine consumption and church attendance (more church predicts less smokin’ and drinkin’) is more than 50% influenced by genetic factors – in adults.  In children and teens, the genetic contribution to the correlation is much less and the strength of the correlation stems more from shared environmental factors (parents, school etc.).  Is there a gene for going to church? Nope.  Are there genes that shape a person’s inclination toward novelty or conscientiousness? More likely so.  Are they distributed across all races and cultures? Yep.  Lots to ponder next Sunday morning.

Reblog this post [with Zemanta]

Read Full Post »

Novelty candles may be used.
Image via Wikipedia

Everyone has a birthday right. Its the day you (your infant self) popped into the world and started breathing, right?  But what about the day “you” were born – that is – “you” in the more philosophical, Jungian, spiritual, social, etc. kind of a way when you became aware of being in some ways apart from others and the world around you.  In her 1997 paper, “The Basal Ganglia and Cognitive Pattern Generators“, Professor Ann Graybiel writes,

The link between intent and action may also have a quite specific function during development. This set of circuits may provide part of the neural mechanism for building up cognitive patterns involving recognition of the self. It is well documented that, as voluntary motor behaviors develop and as feedback about the consequences of these behaviors occurs, the perceptuomotor world of the infant develops (Gibson 1969). These same correlations among intent, action, and consequence also offer a simple way for the young organism to acquire the distinction between actively initiated and passively received events. As a result, the infant can acquire the recognition of self as actor. The iterative nature of many basal ganglia connections and the apparent involvement of the basal ganglia in some forms of learning could provide a mechanism for this development of self-awareness.

As Professor Graybiel relates the “self” to function in the basal-ganglia and the so-called cortico-thalamic basal-ganglia loops – a set of parallel circuits that help to properly filter internal mental activity into specific actions and executable decisions – I got a kick out of a paper that describes how the development of the basal-ganglia can go awry for cells that are born at certain times.

Check out the paper, “Modular patterning of structure and function of the striatum by retinoid receptor signaling” by Liao et al.   It reveals that mice who lack a certain retinoic acid receptor gene (RARbeta) have a type of defective neurogenesis in late-born cells that make up a part of the basal ganglia (striatum) known as a striosome.  Normally, the authors say, retinoic acid helps to expand a population of late-born striosomal cells, but in the RARbeta mutant mice, the rostral striosomes remain under-developed.   When given dopaminergic stimulation, these mutant mice showed slightly less grooming and more sterotypic behaviors.

So when was “my self’s” birthday?  Was it when these late-born striosomal cells were, umm, born?  Who knows, but I’m glad my retinoic acid system was intact.

Reblog this post [with Zemanta]

Read Full Post »

Diagram to illustrate Minute Structure of the ...
Image via Wikipedia

For a great many reasons, research on mental illness is focused on the frontal cortex.  Its just a small part of the brain, and certainly, many things can go wrong in other places during brain/cognitive development, but, it remains a robust finding, that when the frontal cortex is not working well, individuals have difficulties in regulating thoughts and emotions.  Life is difficult enough to manage, let alone without a well functioning frontal cortex.  So its no surprise that many laboratories look very closely at how this region develops prenatally and during childhood.

One of the more powerful genetic methods is the analysis of gene expression via microarrays (here is a link to a tutorial on this technology).  When this technology is coupled with extremely careful histological analysis and dissection of cortical circuits in the frontal cortex, it begins to become possible to begin to link changes in gene expression with the physiological properties of specific cells and local circuits in the frontal cortex. The reason this is an exciting pursuit is because the mammalian neocortex is organized in a type of layered fashion wherein 6 major layers have different types of connectivity and functionality.  The developmental origins of this functional specificity are thought to lie in a process known as radial migration (here is a video of a neuron as it migrates radially and finds its place in the cortical hierarchy).  As cells are queued out of the ventricular zone, and begin their migration to the cortical surface, they are exposed to all sorts of growth factors and morphogens that help them differentiate and form the proper connectivities.  Thus, the genes that regulate this process are of keen interest to understanding normal and abnormal cognitive development.

Here’s an amazing example of this – 2 papers entitled, “Infragranular gene expression disturbances in the prefrontal cortex in schizophrenia: Signature of altered neural development?” [doi:10.1016/j.nbd.2009.12.013] and “Molecular markers distinguishing supragranular and infragranular layers in the human prefrontal cortex [doi:10.1111/j.1460-9568.2007.05396.x] both by Dominique Arion and colleagues.  In both papers, the authors ask, “what genes are differentially expressed in different layers of the cortex?”.  This is a powerful line of inquiry since the different layers of cortex are functionally different in terms of their connectivity.  For example, layers II-III (the so-called supragranular layers) are known to connect mainly to other cortical neurons – which is different functionally than layers V-VI (the so-called infragranular layers) that connect mainly to the striatum (layer V) and thalamus (layer VI).  Thus, if there are genes whose expression is unique to a layer, then one has a clue as to how that gene might contribute to normal/abnormal information processing.

The authors hail from a laboratory that is well-known for work over many years on fine-scaled histological analysis of the frontal cortex at the University of Pittsburgh and used a method called, laser capture microdissection, where post-mortem sections of human frontal cortex (area 46) were cut to separate the infragraular layer from the supragranular layer.  The mRNA from these tissue sections was then used for DNA microarray hybridization.  Various controls, replicate startegies and in-situ tissue hybridizations were then employed to validate the initial microarray results.

In first paper, the where the authors compare infra vs. supragranular layers, they report that 40 genes were more highly expressed in the supragranular layers (HOP, CUTL2 and MPPE1 were among the most enriched) and 29 genes were highly expressed in the infragranular layers (ZNF312, CHN2, HS3ST2 were among the most enriched).  Other differentially expressed genes included several that have previously been implicated in cortical layer formation such as RLN, TLX-NR2E1, SEMA3E, PCP4, SERPINE2, NR2F2/ARP1, PCDH8, WIF1, JAG1, MBP.  Amazing!! A handful of genes that seem to label subpopulations of projection neurons in the frontal cortex.  Polymorphic markers for these genes would surely be powerful tools for imaging-genetic studies on cognitive development.

In the second paper, the authors compare infra vs. supragranular gene expression in post-mortem brains from patients with schizophrenia and healthy matched controls. Using the same methods, the team reports both supra- and infragranular gene expression changes in schizophrenia (400 & 1200 differences respectively) – more than 70% of the differences appearing to be reductions in gene expression in schizophrenia. Interestingly, the team reports that the genes that were differentially expressed in the infragranular layers provided sufficient information to discriminate between cases and controls, whilst the gene expression differences in the supragranular layers did not.  More to the point, the team finds that 51 genes that were differentially expressed in infra- vs. supragranular expression were also differentially expressed in cases vs. controls  (many of these are also found to be associated in population genetic association studies of schiz vs. control as well!).  Thus, the team has identified layer (function) -specific genes that are associated with schizophrenia.  These genes, the ones enriched in the infragranular layers especially, seem to be at the crux of a poorly functioning frontal cortex.

The authors point to 3 such genes (SEMA3E, SEMA6D, SEMA3C) who happen to members of the same gene family – the semaphorin gene family.  This gene family is very important for the neuronal guidance (during radial migration), morphology, pruning and other processes where cell shape and position are regulated.  The authors propose that the semaphorins might act as “integrators” of various forms of wiring during development and in adulthood.  More broadly, the authors provide a framework to understand how the development of connectivity on the frontal cortex is regulated by genetic factors – indeed, many suspected genetic risk factors play a role in the developmental pathways the authors have focused on.

Reblog this post [with Zemanta]

Read Full Post »

One of the complexities in beginning to understand how genetic variation relates to cognitive function and behavior is that – unfortunately – there is no gene for “personality”, “anxiety”, “memory” or any other type of “this” or “that” trait.  Most genes are expressed rather broadly across the entire brain’s cortical layers and subcortical systems.  So, just as there is no single brain region for “personality”, “anxiety”, “memory” or any other type of “this” or “that” trait, there can be no such gene.  In order for us to begin to understand how to interpret our genetic make-up, we must learn how to interpret genetic variation via its effects on cells and synapses – that go on to function in circuits and networks.  Easier said than done?  Yes, but perhaps not so intractable.

Here’s an example.  One of the most well studied circuits/networks/systems in the field of cognitive science are so-called basal-ganglia-thalamcortical loops.  These loops have been implicated in a great many forms of cognitive function involving the regulation of everything from movement, emotion and memory to reasoning ability.  Not surprisingly, neuroimaging studies on cognitive function almost always find activations in this circuitry.  In many cases, the data from neuroimaging and other methodologies suggests that one portion of this circuitry – the frontal cortex – plays a role in the representation of such aspects as task rules, relationships between task variables and associations between possible choices and outcomes.  This would be sort of like the “thinking” part of our mental life where we ruminate on all the possible choices we have and the ins and outs of what each choice has to offer.  Have you ever gone into a Burger King and – even though you’ve known for 20 years what’s on the menu – you freeze up and become lost in thought just as its your turn to place your order?  Your frontal cortex is at work!

The other aspect of this circuitry is the subcortical basla ganglia, which seems to play the downstream role of processing all that ruminating activity going on in the frontal cortex and filtering it down into a single action.  This is a simple fact of life – that we can be thinking about dozens of things at a time, but we can only DO 1 thing at a time.  Alas, we must choose something at Burger King and place our order.  Indeed, one of the hallmarks of mental illness seems to be that this circuitry functions poorly – which may be why individuals have difficulty in keeping their thoughts and actions straight – the thinking clearly and acting clearly aspect of healthy mental life.  Certainly, in neurological disorders such as Parkinson’s Disease and Huntington’s Disease, where this circuitry is damaged, the ability to think and move one’s body in a coordinated fashion is disrupted.

Thus, there are at least 2 main components to a complex system/circuits/networks that are involved in many aspects of learning and decision making in everyday life.  Therefore, if we wanted to understand how a gene – that is expressed in both portions of this circuitry – inflenced our mental life, we would have to interpret its function in relation to each specific portion of the circuitry.  In otherwords, the gene might effect the prefrontal (thinking) circuitry in one way and the basla-ganglia (action-selection) circuitry in a different way.  Since we’re all familiar with the experience of walking in to a Burger King and seeing folks perplexed and frozen as they stare at the menu, perhaps its not too difficult to imagine that a gene might differentially influence the ruminating process (hmm, what shall I have today?) and the action selection (I’ll take the #3 combo) aspect of this eveyday occurrance (for me, usually 2 times per week).

Nice idea you say, but does the idea flow from solid science?  Well, check out the recent paper from Cindy M. de Frias and colleagues “Influence of COMT Gene Polymorphism on fMRI-assessed Sustained and Transient Activity during a Working Memory Task.” [PMID: 19642882].  In this paper, the authors probed the function of a single genetic variant (rs4680 is the Methionine/Valine variant of the dopamine metabolizing COMT gene) on cognitive functions that preferentially rely on the prefronal cortex as well as mental operations that rely heavily on the basal-ganglia.  As an added bonus, the team also probed the function of the hippocampus – yet a different set of circuits/networks that are important for healthy mental function.  OK, so here is 1 gene who is functioning  within 3 separable (yet connected) neural networks!

The team focused on a well-studied Methionine/Valine variant of the dopamine metabolizing COMT gene which is broadly expessed across the pre-frontal (thinking) part of the circuitry and the basal-ganglia part of the circuitry (action-selection) as well as the hippocampus.  The team performed a neuroimaging study wherein participants (11 Met/Met and 11 Val/Val) subjects had to view a series of words presented one-at-a-time and respond if they recalled that a word was a match to the word presented 2-trials beforehand  (a so-called “n-back task“).  In this task, each of the 3 networks/circuits (frontal cortex, basal-ganglia and hippocampus) are doing somewhat different computations – and have different needs for dopamine (hence COMT may be doing different things in each network).  In the prefrontal cortex, according to a theory proposed by Robert Bilder and colleagues [doi:10.1038/sj.npp.1300542] the need is for long temporal windows of sustained neuronal firing – known as tonic firing (neuronal correlate with trying to “keep in mind” all the different words that you are seeing).  The authors predicted that under conditions of tonic activity in the frontal cortex, dopamine release promotes extended tonic firing and that Met/Met individuals should produce enhanced tonic activity.  Indeed, when the authors looked at their data and asked, “where in the brain do we see COMT gene associations with extended firing? they found such associations in the frontal cortex (frontal gyrus and cingulate cortex)!

Down below, in the subcortical networks, a differerent type of cognitive operation is taking place.  Here the cells/circuits are involved in the action selection (press a button) of whether the word is a match and in the working memory updating of each new word.  Instead of prolonged, sustained “tonic” neuronal firing, the cells rely on fast, transient “phasic” bursts of activity.  Here, the modulatory role of dopamine is expected to be different and the Bilder et al. theory predicts that COMT Val/Val individuals would be more efficient at modulating the fast, transient form of cell firing required here.   Similarly, when the research team explored their genotype and brain activity data and asked, “where in the brain do we see COMT gene associations with transient firing? they found such associations in the right hippocampus.

Thus, what can someone who carries the Met/Met genotype at rs4680 say to their fellow Val/Val lunch-mate next time they visit a Burger King?  “I have the gene for obesity? or impulsivity? or “this” or “that”?  Perhaps not.  The gene influences different parts of each person’s neural networks in different ways.  The Met/Met having the advantage in pondering (perhaps more prone to annoyingly gaze at the menu forever) whist the Val/Val has the advantage in the action selecting (perhaps ordering promptly but not getting the best burger and fries combo).

Reblog this post [with Zemanta]

Read Full Post »

We hope, that you choke, that you choke.
Image by Corrie… via Flickr

Coping with fear and anxiety is difficult.  At times when one’s life, livelihood or loved one’s are threatened, we naturally hightenen our senses and allocate our emotional and physical resources for conflict.  At times, when all is well, and resources, relationships and relaxation time are plentiful, we should unwind and and enjoy the moment.  But most of us don’t.  Our prized cognitive abilities to remember, relive and ruminate on the bad stuff out there are just too well developed – and we suffer – some more than others  (see Robert Saplosky’s book “Why Zebras Don’t Get Ulcers” and related video lecture (hint – they don’t get ulcers because they don’t have the cognitive ability to ruminate on past events).  Such may be the flip side to our (homo sapiens) super-duper cognitive abilities.

Nevertheless, we try to understand our fears and axieties and understand their bio-social-psychological bases. A recent paper entitled, “A Genetically Informed Study of the Association Between Childhood Separation Anxiety, Sensitivity to CO2, Panic Disorder, and the Effect of Childhood Parental Loss” by Battaglia et al. [Arch Gen Psychiatry. 2009;66(1):64-71] brought to mind many of the complexities in beginning to understand the way in which some individuals come to suffer more emotional anguish than others.  The research team addressed a set of emotional difficulties that have been categorized by psychiatrists as “panic disorder” and involving sudden attacks of fear, sweating, racing heart, shortness of breath, etc. which can begin to occur in early adulthood.

Right off the bat, it seems that one of the difficulties in understanding such an emotional state(s) are the conventions (important for $$ billing purposes) used to describe the relationship between “healthy” and “illness” or “disorder”.  I mean, honestly, who hasn’t experienced what could be described as a mild panic disorder once or twice?  I have, but perhaps that doesn’t amount to a disorder.  A good read on the conflation of normal stress responses and disordered mental states is “Transforming Normality into Pathology: The DSM and the Outcomes of Stressful Social Arrangements” by Allan V. Horwitz.

Another difficulty in understanding how and why someone might experience such a condition has to do with the complexities of their childhood experience (not to mention genes). Child development and mental health are inextrictably related, yet, the relationship is hard to understand.  Certainly, the function of the adult brain is the product of countless developmental unfoldings that build upon one another, and certainly there is ample evidence that when healthy development is disrupted in a social or physical way, the consequences can be very unfortunate and long-lasting. Yet, our ability to make sense of how and why an individual is having mental and/or emotional difficulty is limited.  Its a complex, interactive and emergent set of processes.

What I liked about the Battaglia et al., article was the way in which they acknowledged all of these complexities and – using a multivariate twin study design – tried to objectively measure the effects of genes and environment (early and late) as well as candidate biological pathways (sensitivity to carbon dioxide).  The team gathered 346 twin pairs (equal mix of MZ and DZ) and assessed aspects of early and late emotional life as well as the sensitivity to the inhalation of 35% CO2 (kind of feels like suffocating and is known to activate fear circuitry perhaps via the ASC1a gene).   The basic notion was to parcel out the correlations between early emotional distress and adult emotional distress as well as with a very specific physiological response (fear illicited by breathing CO2).  If there were no correlation or covariation between early and late distress (or the physiological response) then perhaps these processes are not underlain by any common mechanism.

However, the team found that there was covariation between early life emotion (criteria for separation anxiety disorder) and adult emotion (panic disorder) as well as the physiological/fear response illicited by CO2.  Indeed there seems to be a common, or continuous, set of processes whose disruption early in development can manifest as emotional difficulty later in development.  Furthermore, the team suggests that the underlying unifying or core process is heavily regulated by a set of additive genetic factors.  Lastly, the team finds that the experience of parental loss in childhood increased (but not via an interaction with genetic variation) the strength of the covariation between early emotion, late emotion and CO2 reactivity.  The authors note several limitations and cautions to over-interpreting these data – which are from the largest such study of its kind to date.

For individuals who are tangled in persistent ruminations and emotional difficulties, I don’t know if these findings help.  They seem to bear out some of the cold, cruel logic of life and evolution – that our fear systems are great at keeping us alive when we’ve had adverse experience in childhood, but not necessarily happy.  On the other hand, the covariation is weak, so there is no such destiny in life, even when dealt unfortunate early experience AND genetic risk.  I hope that learning about the science might help folks cope with such cases of emotional distress.

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »