Posts Tagged ‘Depression’

Modified drawing of the neural circuitry of th...
Image via Wikipedia

You already know this, but when you are stressed out (chronic stress), your brain doesn’t work very wellThat’s right – just when you need it most – your brain has a way of letting you down!

Here are a few things that happen to the very cells (in the hippocampus) that you rely on:

reorganization within mossy fiber terminals
loss of excitatory glutamatergic synapses
reduction in the surface area of postsynaptic densities
marked retraction of thorny excrescences
alterations in the lengths of the terminal dendritic segments of pyramidal cells
reduction of the dorsal anterior CA1 area volume

Thanks brain!  Thanks neurons for abandoning me when I need you most!  According to this article, these cellular changes lead to, “impaired hippocampal involvement in episodic, declarative, contextual and spatial memory – likely to debilitate an individual’s ability to process information in new situations and to make decisions about how to deal with new challenges.” UGH!

Are our cells making these changes for a reason?  Might it be better for cells to remodel temporarily rather than suffer permanent, life-long damage?  Perhaps.  Perhaps there are molecular pathways that can lead the reversal of these allostatic stress adaptations?

Check out this recent paper: “A negative regulator of MAP kinase causes depressive behavior” [doi 10.1038/nm.2219]  the authors have identified a gene – MKP-1 – a phosphatase that normally dephosphorylates various MAP kinases involved in cellular growth, that, when inactivated in mice, produces animals that are resistant to chronic unpredictable stress.  Although its known that MKP-1 is needed to limit immune responses associated with multi-organ failure during bacterial infections, the authors suggest:

“pharmacological blockade of MKP-1 would produce a resilient of anti-depressant response to stress”

Hmmm … so Mother Nature is using the same gene to regulate the immune response (turn it off so that it doesn’t damage the rest of the body) and to regulate synaptic growth (turn it off – which is something we DON’T want to do when we’re trying to recover from chronic stress)?  Mother Nature gives us MKP-1 so I can survive an infection, but the same gene prevents us from recovering (finding happiness) from stress?

Of course, we do not need to rely only on pharmacological solutions.  Exercise & social integration are cited by these authors as the top 2 non-medication strategies.

Enhanced by Zemanta

Read Full Post »

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta

Read Full Post »

Corticotropin-releasing hormone
Image via Wikipedia

According to the authors of  “Protective effect of CRHR1 gene variants on the development of adult depression following childhood maltreatment: replication and extension”  [PMID: 19736354], theirs is “the first instance of Genes x Environment research that stress has been ascertained by more than 1 study using the same instrument“.  The gene they speak of is the Corticotropin-releasing hormone receptor 1 (CRHR1) gene (SNPs rs7209436, rs110402, rs242924 which can form a so-called T-A-T haplotype which has been associated with protection from early life stress (as ascertained using the Childhood Trauma Questionnaire CTQ)).

The research team examined several populations of adults and, like many other studies, found that early life stress was associated with symptoms of depressive illness but, like only 1 previous study, found that the more T-A-T haplotypes a person has (0,1,or 2) the less likely they were to suffer these symptoms.

Indeed, the CRHR1 gene is an important player in a complex network of hormonal signals that regulate the way the body (specifically the hypothalamic pituitary adrenal axis) transduces the effects of stress.  So it seems quite reasonable to see that individual differences in ones ability to cope with stress might correlate with genotype here.   The replication seems like a major step forward in the ongoing paradigm shift from “genes as independent risk factors” to “genetic risk factors being dependent on certain environmental forces”.  The authors suggest that a the protective T-A-T haplotype might play a role in the consolidation of emotional memories and that CRHR1 T-A-T carriers might have a somewhat less-efficient emotional memory consolidation (sort of preventing disturbing memories from making it into long-term storage in the first place?) – which is a very intriguing and testable hypothesis.

On a more speculative note … consider the way in which the stress responsivity of a developing child is tied to its mother’s own stress responsivity.  Mom’s own secretion of CRH from the placenta is known to regulate gestational duration and thus the size, heartiness and stress responsiveness of her newborn.  The genetic variations are just passed along from generation to generation and provide some protection here and there in an intertwined cycle of life.

The flowers think they gave birth to seeds,
The shoots, they gave birth to the flowers,
And the plants, they gave birth to the shoots,
So do the seeds they gave birth to plants.
You think you gave birth to the child.
None thinks they are only entrances
For the life force that passes through.
A life is not born, it passes through.

anees akbar

Reblog this post [with Zemanta]

Read Full Post »

Twin studies have long suggested that genetic variation is a part of healthy and disordered mental life.  The problem however – some 10 years now since the full genome sequence era began – has been finding the actual genes that account for this heritability.

It sounds simple on paper – just collect lots of folks with disorder X and look at their genomes in reference to a demographically matched healthy control population.  Voila! whatever is different is a candidate for genetic risk.  Apparently, not so.

The missing heritability problem that clouds the birth of the personal genomes era refers to the baffling inability to find enough common genetic variants that can account for the genetic risk of an illness or disorder.

There are any number of reasons for this … (i) even as any given MZ and DZ twin pair shares genetic variants that predispose them toward the similar brains and mental states, it may be the case that different MZ and DZ pairs have different types of rare genetic variation thus diluting out any similar patterns of variation when large pools of cases and controls are compared …  (ii) also, the way that the environment interacts with common risk-promoting genetic variation may be quite different from person to person – making it hard to find variation that is similarly risk-promoting in large pools of cases and controls … and many others I’m sure.

One research group recently asked whether the type of common genetic variation(SNP vs. CNV) might inform the search for the missing heritability.  The authors of the recent paper, “Genome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls” [doi:10.1038/nature08979] looked at an alternative to the usual SNP markers – so called common copy number variants (CNVs) – and asked if these markers might provide a stronger accounting for genetic risk.  While a number of previous papers in the mental health field have indeed shown associations with CNVs, this massive study (some 3,432 CNV probes in 2000 or so cases and 3000 controls) did not reveal an association with bipolar disorder.  Furthermore, the team reports that common CNV variants are already in fairly strong linkage disequilibrium with common SNPs and so perhaps may not have reached any farther into the abyss of rare genetic variation than previous GWAS studies.

Disappointing perhaps, but a big step forward nonetheless!  What will the personal genomes era look like if we all have different forms of rare genetic variation?

Reblog this post [with Zemanta]

Read Full Post »

Just a pointer to a great book – The Loss of Sadness: How Psychiatry Transformed Normal Sorrow into Depressive Disorder by Allan V. Horwitz and Jerome C. Wakefield.  Its an in-depth treatment on the many reasons and contexts in which we – quite naturally – feel sad and depressed and the way in which diagnostic criteria can distort the gray area between normal sadness and a psychiatric disorder.  I really enjoyed the developmental perspective on the natural advantages of negative emotions in childhood (a signal to attract caregivers) as well as the detailed evolution of the DSM diagnostic criteria.  The main gist of the book is that much of what psychiatrists treat as emotional disorders are more likely just the natural responses to the normal ups and downs of life – not disorders at all.  A case for American consumers as pill-popping suckers to medical-pharma-marketing overreach (here’s a related post on this overreach notion pointing to the work of David Healy).

Reading the book makes me feel liberated from the medical labels that are all too readily slapped on healthy people.  There is much that is healthy about sadness and many reasons and contexts in which its quite natural.  From now on, instead of trying to escape from, or rid myself of sadness, I will embrace it and let myself feel it and work through it.  Who knows, maybe this is a good first step in a healthy coping process.

If depressed emotional states are more a part of the normal range of emotions (rather than separate disordered states) then does this allow us to make predictions about the underlying genetic bases for these states?    Perhaps not.   However, on page 172, the authors apply their critical view to the highly cited Caspi et al., article (showing that 5HTT genotype interacts with life stress in the presentation of depressive illness – critiqued here).  They note that the incidence of depression at 17% in the sample is much too high – most certainly capturing a lot of normal sadness.  Hence, the prevalent short allele in the 5HTT promoter might be better thought of as a factor that underlies how healthy people respond to social stress – rather than as a drug target or risk factor for psychiatric illness.

Reblog this post [with Zemanta]

Read Full Post »

Crocus (cropped)
Image by noahg. via Flickr

If you’ve started to notice the arrival of spring blossoms, you may have wondered, “how do the blossoms know when its spring?”  Well, it turns out that its not the temperature, but rather, that plants sense the length of the day-light cycle in order to synchronize their  own life cycles with the seasons.  According to the photoperiodism entry for wikipedia, “Many flowering plants use a photoreceptor protein, such as phytochrome or cryptochrome, to sense seasonal changes in night length, or photoperiod, which they take as signals to flower.”

It turns out that humans are much the same. Say wha?!

Yep, as the long ago descendants of single cells who had to eek out a living during day (when the sun emits mutagenic UV radiation) and night cycles, our very own basic molecular machinery that regulates the transcription, translation, replication and a host of other cellular functions is remarkably sensitive – entrained – in a clock-like fashion to the rising and setting sun.  This is because, in our retinas, there are light-sensing cells that send signals to the suprachiasmatic nucleus (SCN) which then – via the pineal gland – secretes systemic hormones such as melatonin that help synchronize cells and organs in your brain and body.  When this process is disrupted, folks can feel downright lousy, as seen in seasonal affective disorder (SAD), delayed sleep phase syndrome (DSPS) and other circadian rhythm disorders.

If you’re skeptical, consider the effects of genetic variation in genes that regulate our circadian rhythms, often called “clock” genes – very ancient genes that keep our cellular clocks synchronized with each other and the outside environment.  Soria et al., have a great paper entitled, “Differential Association of Circadian Genes with Mood Disorders: CRY1 and NPAS2 are Associated with Unipolar Major Depression and CLOCK and VIP with Bipolar Disorder” [doi: 10.1038/npp.2009.230] wherein they reveal that normal variation in these clock genes is associated with mood regulation.

A few of the highlights reported are rs2287161 in the CRY1 gene,  rs11123857 in the NPAS2 gene, and rs885861 in the VIPR2 gene – where the C-allele, G-allele and C-allele, respectively, were associated with mood disorders.

I’m not sure how one would best interpret genetic variation of such circadian rhythm genes.  Perhaps they index how much a person’s mood could be influenced by changes or disruptions to the normal rhythm??  Not sure.  My 23andMe data shows the non-risk AA genotype for rs11123857 (the others are not covered by 23andMe).

Reblog this post [with Zemanta]

Read Full Post »

Eight women representing prominent mental diag...
Image via Wikipedia

pointer to – fantastic video resource of specific symptoms of mental illness.

“The intention of these clips are to be used in the classroom setting as visual compliments to the written description of symptoms for psychological phenomena found in the DSM handbook.”

Reblog this post [with Zemanta]

Read Full Post »

Older Posts »