Feeds:
Posts
Comments
Climber Hands
Image by Dru! via Flickr

If you’ve practiced yoga, you’ve probably heard these common admonitions: ” Yoga is 1% theory and 99% practice“, “Yoga is for everyman – except the lazy man” etc., etc..   Me too. So I perked up when reading this article entitled, “The truth about grit: Modern science builds the case for an old-fashioned virtue – and uncovers new secrets to success“.

In recent years, psychologists have come up with a term to describe this mental trait: grit. Although the idea itself isn’t new – “Genius is 1 percent inspiration and 99 percent perspiration,” Thomas Edison famously remarked – the researchers are quick to point out that grit isn’t simply about the willingness to work hard. Instead, it’s about setting a specific long-term goal and doing whatever it takes until the goal has been reached. It’s always much easier to give up, but people with grit can keep going.

What is “grit”?  Can it be taught?  Is it genetic?  Do I have a goal (to one day touch my heels to the mat in downward dog)?  The article highlights a psychologist by the name of Angela Duckworth who has some amazing research on the development of persistence and self-control.  Check out her (freely downloadable) research articles and “grit” assessments – used nowadays to predict who is likely to drop-out when the going gets tough.

It turns out that in life – just as in yoga – grit matters.  It matters more than personality, intelligence or the amount of money you can spend.

Enhanced by Zemanta

Muladhara

The human brain has some 100 billion neurons.  That sounds like a lot, but I’m still keen on keeping ALL of mine healthy and in good working order.  One way that cells protect themselves from damage and untimely death is by protecting their DNA – by wrapping it up and coiling it tightly – using chromatin proteins – which keeps it away from chemical and viral damage.  This is especially important in the brain, since – unlike the skin or gut – we can’t really re-grow brain tissue once its damaged.  We have to protect the neurons we have!

Here’s the problem. In order to USE the BRAIN (to learn and remember stuff) we have to also USE the GENOME (to encode the proteins that synapses use in the process of memory formation).  When we’re thinking, we have to take our precious DNA out of its protective supercoiled, proteinaceous shell and allow the double helix to melt into single strands and expose their naked A’s, G’s, T’s and C’s to the chemical milieu (to the start the transcription process).  This is risky business damage to DNA can lead to cell death!

One might imaging that its best to carry out this precarious act quickly and in proximity to DNA repair enzymes (I’d think).  A very important job that includes: uncoiling chromatin superstructures, transcribing DNA (that encodes proteinaceous building blocks that synapses use to strengthen and weaken themselves) – and then – making sure there was no damage incurred along the way.  A BIG job that MUST get done each and every time my cells engage in learning.  Wow!  I didn’t realize that learning new stuff means I’m exposing my DNA to damage?  Hmm … I wonder if that PhD was worth it?

To perform this important job, it seems there is an amazing handyman of a molecule named poly(ADP-ribose) polymerase-1 (PARP-1).  Amazing, because it – itself – can function in many of the steps involved in uncoiling chromatin structures, transcription initiation and DNA repair.  The protein that can “do it all” … get the job done quickly and even fix any errors made along the way! It is known to function in the so-called base excision repair (BER) pathway and is also known have a role in transcription through remodeling of chromatin by ADP-ribosylating histones and relaxing chromatin structure, thus allowing transcription to occur (click here for a great open review of PARP-1).  Nice!

According to OMIM, earlier studies by Cohen-Armon et al. (2004) found that poly(ADP-ribose) polymerase-1 is activated in neurons that mediate several forms of long-term memory in Aplysia. Because poly(ADP-ribosyl)ation of nuclear proteins is a response to DNA damage in virtually all eukaryotic cells (indeed, PARP-1 knock-out mice are more sensitive to DNA damage), it was surprising that activation of the polymerase occurred during learning and was required for long-term memory. Cohen-Armon et al. (2004) suggested that the fast and transient decondensation of chromatin structure by poly(ADP-ribosyl)ation enables the transcription needed to form long-term memory without strand breaks in DNA.

A recent article in Journal of Neuroscience seems to confirm this function –  now in the mouse brain.  Histone H1 Poly[ADP]-Ribosylation Regulates the Chromatin Alterations Required for Learning Consolidation [doi:10.1523/JNEUROSCI.3010-10.2010] by Fontán-Lozano et al., examined cells in the hippocampus at different times during the learning of an object recognition paradigm.  They confirm (using a PARP-1 antagonist) that PARP-1 is needed to establish object memory and also that PARP-1 seems to contribute during the paradigm and up to 2 hours after the training session.  They suggest that the poly(ADP-ribosyl)ation of histone H1 influences whether H1 is bound or unbound and thus helps regulate the opening and closing of the chromatin so that transcription can take place. 

Nice to know that PARP-1 is on the job!  Still am wondering if the PhD was worth all the learning.  Are there trade-offs at play here?  MORE learning vs. LESS something?   Perhaps. Check out the paper by Grube and Bürkle (1992) – Poly(ADP-ribose) polymerase activity in mononuclear leukocytes of 13 mammalian species correlates with species-specific life span. This gene may influence life span!

Enhanced by Zemanta

Yoga word clouds

Just a bit of fun with Wordle (the bigger the word in the cloud, the more frequently it occurs in the source text).  Here are clouds for an English translation of Patanjali’s Yoga Sutras and The Hatha Yoga Pradipika (English and Sanskrit).  I love that the word “mind” is one of the most prominent words for both of these fundamental yoga teachings … seems to reveal that the practice has always been about the mind.

Last night I was watching a TV show on the story of The Buddha.   There was a part in the story where, “Siddhartha saw a man lying on the ground and moaning. Out of compassion, he rushed over to the man. Channa warned him that the man was sick and that everyone, even noble people like Siddhartha or the king could get sick.” Later, “Siddhartha lost all interest in watching the dancing girls and other such pleasures.  He kept on thinking instead about how to free himself and others from sickness, ageing and death.”

When Siddhartha looked at the beautiful young dancers, he saw them as old, dying women and felt empathy for the suffering they would endure in their lives.

This part of the story reminded me of the way mass marketeers often use sexuality to market yoga, and the backlash it creates.   I thought that this moment in Siddhartha’s life really captured the “true” spirit of yoga/Buddhism – in stark contrast to so many slick, sexy advertisements.  Yoga and meditation – while enjoyed by many young and beautiful people – provides something deeper – a path to cope with the painful, frightening and inexorable loss one’s health, (outer) beauty, memory and breath.

I’d be a hypocrite to say I’m averse to the “sex sells” media, but Siddhartha’s insight is one to keep in mind – and heart.

Well, technically, all rivers are sacred … perhaps even the Rahway River?

Here it sits in Varanasi, the holiest place in the Hindu world, alongside the Ganges River.

Peter Mark Roget (Roget's Thesaurus)
Image by dullhunk via Flickr

On Fridays, after a regular practice session, our shala is open for quiet meditation.  This is a new experience for me, even as I’ve read much about the mental and physical health benefits accrued by experienced practitioners.  As someone who is totally exhausted after practice – indeed, I couldn’t move another muscle even if I wanted – I always think it will be easy to settle in, and pass 30 minutes  in quiet stillness.

Sure enough though, even as my body is spent and motionless, my mind starts to wander, and wander, and wander some more.  “Damn”, I think, “here we go again”. Just a few minutes in, and I’m losing a battle – with myself.  “This is going to be the longest 30 minutes of my life!” What to do?

Some experts say to simply LABEL your thoughts and feelings.  Just find a word to place on the thought or feeling – and then – let it go.  Does this really work?  How does this trick work?

Recent brain imaging studies seem to show that when a word is applied to a negative emotion,  the brain changes how it processes that emotion and shifts processing to neural systems that avoid centers of the brain (the amygdala, in particular) that send neural projections to our face, gut and heart (areas where we tend to physically “feel” our bad feelings).   It seems that our ability to use words is an important tool in how we cope with emotional experience.  Either we succumb to the storms of negative emotions that can well up inside us from time to time (and feel lousy inside), or we can manage these feelings – using our words – and feel less lousy inside.   Apparently, the use of words, alters neural processing – leading us to experience less tightening in the chest, clenching in the gut, etc.,  etc. than we would otherwise feel when negative emotions come over us.  One of the researchers, David Cresswell, remarks: “This is an exciting study because it brings together the Buddha‘s teachings – more than 2,500 years ago, he talked about the benefits of labeling your experience – with modern neuroscience.”

But this is easier said than done.

How do I label a thought?  How do I label an emotion?  I mean, “I feel, um, um, frustrated, lousy, anxious … crap … I’m not exactly sure how I feel?  What’s the word I’m looking for?”

Indeed – the words – the words – as in, “In the beginning was the Word, and the Word was with God, and the Word was God.” WORDS.  Do I know enough words?  How many words are there anyway to describe all the possible feelings that a person can feel?  How many do you know?

Check this list out.    There are more than 3,000 words in the English language to describe various feelings.  Thank you Peter Mark Roget (who, ironically, worked on the first thesaurus as a means to cope with negative feelings associated with depression).  I will bring my thesaurus – full of these tools to help me label my feelings – to meditation practice from now on!

Enhanced by Zemanta

Thanks to Yoga Dork for this great post on yoga at the NY Giants!

signaling (animated)
Image by Genista via Flickr

One thing I’ve learned doing yoga is that introspection – like the postures – takes a lot of practice.

Here’s a pointer to a great new science article on the basic brain biology of introspection, or “thinking about thinking”.  The article, Relating Introspective Accuracy to Individual Differences in Brain Structure by Fleming et al., describes experiments where participants had to (a) make a rather difficult perceptual observation and then (b) self-report how confident they were in that judgment.  From the introduction …

Our moment-to-moment judgments of the outside world are often subject to introspective interrogation. In this context, introspective or “metacognitive” sensitivity refers to the ability to discriminate correct from incorrect perceptual decisions, and its accuracy is essential for the appropriate guidance of decision-making and action.

… sounds a lot like the way people describe meditation as being an active or “aware” state where (a) very basic perceptual information (sounds, feelings, vibrations) are (b) seamlessly coupled, labeled or processed with more abstract and/or deeper thoughts.  As Thomas Metzinger suggests in his book, The Ego Tunnel, the ability to become “aware” of early sensory perceptions is an important aspect of understanding the so-called “real world” as opposed to the world that our ego, or conscious mind normally builds for us.  Metzinger points to Paul Churchland‘s ideas on “eliminative materialsm” as emphasizing the importance of (a) early sensory experience and its (b) coupling with introspective abilities.  Churchland’s ideas (from p53 in Metzinger’s book):

“I suggest then, that those of us who prize the flux and content of our subjective phenomenological experience need not view the advance of materialist neuroscience with fear and foreboding.” … “Quite the contrary.  The genuine arrival of a materialist kinematics and dynamics for psychological states and cognitive processes will constitute not a gloom in which our inner life is suppressed or eclipsed, but rather a dawning, in which its marvelous intricacies are finally revealed – most notably, if we apply [it] ourselves, in direct self-conscious introspection.”

Churchland’s notion of a revelation of our true inner lives (via an understanding of sensory processes) – loosely – reminds me of some of the ancient yogic notions of a gap between the “real” world and our everyday “mental” world.  These notions are a core of yoga spirituality.  As covered in-depth by Mircea Eliade in Yoga: Immortality and Freedom:

For Samkhya and Yoga the problem is clearly defined.  Since suffering has its origins in ignorance of “Spirit” – that is,  in confusing “Spirit” with psychomental states – emancipation can be obtained only if the confusion is abolished. (p14)   …   Yoga accepts God, but we shall see that Patanjali does not accord him very much importance.  The revelation is based on knowledge of the ultimate reality – that is, on an “awakening” in which object completely identifies itself with subject.  (The “Self” “”contemplates” itself;  it does not “think” itself, for thought is itself an experience and, as such, belongs to praktri.)(p29)

So it seems that both the ancient yogis and some modern scientists suggest that there is indeed a gap between the way the world really “is” and the way we “think” about it.  To close this gap, it may help to train ourselves to the difference between “contemplating” – which emphasizes basic sensory information (listening, feeling, etc.) – rather than just “thinking” about stuff.  I think this aspect of our mental life may be, in part, what Churchland is emphasizing and also is one of the most basic tenets of vipassana meditation.

Just focus on the basic sensory perceptions … live in this moment!

The brain scientists who performed the research on the relation of (a) basic sensory perceptual processes to (b) judgments of its accuracy used brain imaging to examine correlations in brain structure (gray matter volume and white-matter integrity) with performance on the (a) and (b) tasks and found a number of brain regions in the very front of the brain that were correlated with “introspective ability” (more on the science here).  I wonder if they were thinking of mediation when they wrote:

This raises the tantalizing possibility of being able to “train” metacognitive ability by harnessing underlying neural plasticity in the regions that we identify here.

I suppose a few old ascetic yogis out there might have chuckle at the thought of a western “training program” (just 10 minutes a day, no batteries required etc.) … methinks it takes practice – A LOT of practice!

Enhanced by Zemanta

What is the sound of Aum?

gamma waves.
Image via Wikipedia

Have you ever wondered what is the proper musical note to sound when singing AUM at the beginning of class?

Tonight, I was blessed to chant along with Girish who led a kirtan at my yoga shala.  According to him, “AUM” is traditionally played using a low E-chord.  He played his low E chord on his harmonium and we chanted aum – again and again and again! He also said (just paraphrasing his informal comments tonight), that this E-chord is not just a random choice, but that its also the sound that comes from within our minds when we meditate.  Hmm, I wondered – cool thought indeed – but is he just making this up? I mean, what could he know (or ancient yogis for that matter) about what is really, actually happening in the mind?

It turns out that modern science can actually “listen” to the brain when it is meditating – by placing listening devices (small electrodes on the scalp) and measuring oscillations of neuro-electrical activity (electroencephalography or EEG).  Experienced meditators show an increase in the strength of one particular “note” or frequency – a so-called gamma wave, or gamma frequency of about 40Hz when they reach deep meditative states.  According to wikipedia:

A gamma wave is a pattern of brain waves in humans with a frequency between 25 to 100 Hz, though 40 Hz is prototypical. … Experiments on Tibetan Buddhist monks have shown a correlation between transcendental mental states and gamma waves.  A suggested explanation is based on the fact that the gamma is intrinsically localized. Neuroscientist Sean O’Nuallain suggests that this very existence of synchronized gamma indicates that something akin to a singularity – or, to be more prosaic, a conscious experience – is occurring.

OK, so modern science measures brain activity in deep meditators and finds that 40Hz is the vibration associated with deep meditative states.  Girish says AUM is also the vibration of deep meditative states and is traditionally a low E-chord.  OK, so then, is he right?  What’s the frequency of low E?  Is it 40Hz?

41.2Hz! Pretty darn amazing!

Enhanced by Zemanta

Last night I sat together with my 6 y.o. son at a kirtan in our yoga shala listening, clapping, chanting and singing along with Girish and his band.  My little guy is something of a yogi himself – even though we’re both newbies to yoga.  (At left is his drawing of  yoga class.)

At some point during the performance, as we sat together on the floor and the vibrations pulsed through us, I looked down at his gentle innocent face – and it suddenly dawned on me – why I’ve been feeling so compelled to expose him (and his younger brother) to kids yoga classes – not to mention kirtans.

Someday, I’ll be long gone from this world.

How will my children find me when I gone?

Where will they look?

How can they find comfort in time of distress?  How can they connect with “me” – my heart and soul?

There amidst the chanting, it became clear – that yoga, being a form of spirituality in its barest, stripped-down most primitive form – is a way that folks come to know their true selves, heart and soul.

Suddenly I realized that, someday when I am long gone, my sons will be able to find “me” –  my own self, heart and soul – RIGHT HERE! On the bare floor – wherever they are – between their own hands,  in the place where their own beads of sweat fall.  They will find their own selves – hearts and souls – in their practice – and know that their dad found his true self, heart and soul right there – in the very same place – where the sweat falls from the brow.

It felt so wonderfully comforting to realize that there IS a way to stay connected.  To share a living, breathing bond that survives long after the body.  There is a path! I think doing yoga with my kids is a way to build a passageway – through space and time – to find each other again – long after we leave this world.  I will never forget that moment of clarity.

I’ve seen many great dads in my town, and I think they all feel the same way – whether it be baseball, football, basketball, soccer etc.  Yoga – although a deeply spiritual endeavor – does not have to be special in this regard (you should see some of the fanatical baseball dads in my town!).  Perhaps, we all imagine that someday, our kids will play and teach their own kids in the same way we taught them.  Perhaps, many years from now, they’ll stop for a moment and think fondly of us – about the simple joy they shared, and – in that instant – realize that there is a living bond that cuts across space and time.

Whatever you LOVE to do –> teach it to your kids and you will forge a bond that survives long after you are gone!

Riding my bike to yoga class

Raging River, Preston WA
Image by Preconscious Eye via Flickr

As a parent, there are times when I realize that the world of my children is not the world I grew up in.  Yes, the Readin’, ‘Ritin’ & ‘Ritmetic are still just as important … and there is nothing as precious as apple pie and little league in the spring … and yes, kids must eat their vegetables and say their prayers at night.  Just as its always been – and will always be.  The wider technological and economic world of my children, however, is much different – most obviously altered by the recent rise of computer technology that “creatively destroys” all forms of industrial activity (media, finance, trade, healthcare) across the globe.  Such change, while unsettling, is, itself, nothing new.  Just teach the children to adapt and, like every generation before, your children will be fine.  OK.

With this in mind, I enjoyed the recent NY Times article, “Outdoors and Out of Reach, Studying the Brain” that describes a rafting expedition of neuroscientists who ventured down a remote river in Utah – purposefully out of touch with computer technology – in order to ponder how computer technology, in the form of our email, video gaming, texting etc., etc. shape our mental experience and mental health.  According to the article:

It was a primitive trip with a sophisticated goal: to understand how heavy use of digital devices and other technology changes how we think and behave, and how a retreat into nature might reverse those effects.

In particular, the team was focused on the neural systems that help us pay attention.

David Strayer, a psychology professor at the University of Utah, says that studying what happens when we step away from our devices and rest our brains — in particular, how attention, memory and learning are affected — is important science.  “Attention is the holy grail,” Mr. Strayer says.”  “Everything that you’re conscious of, everything you let in, everything you remember and you forget, depends on it.

Every parent knows that kids are increasingly hooked on this and that computer device.  We know that these devices constantly serve up all manner of entertaining news, sports scores, gossip, visual images, games, etc. etc.    Unfortunately, we also know that so-called “intermittent reinforcement”, “variable ratio of reinforcement” or “random reinforcement” can be just as addictive as any drug (the red line in the chart here shows how much more reinforcing “random” rewards are than fixed, predictable rewards).  This is why these devices are – in every sense of the word – ADDICTIVE.  They offer up a steady, but unpredictably so, stream of rewarding images and bits of information.  I mean, how many times a day do you check your email and favorite websites?  Do you feel disappointed when there is nothing juicy – but can’t help checking “just one more time”?

Hence, computer technology presents a quandary for all of us – grown ups and kids alike.  How to adapt to, and manage this “new normal” of hand-held, computer-based, ubiquitous access to social and entertainment information?

Although the trip did not yield THE definitive answer, it seemed to prompt the scientists to take a closer look at the effects and value of conecting/disconnecting from computer technology.  For Professor Todd Braver, a neuroscientist from Washington University:

When he gets back to St. Louis, he says, he plans to focus more on understanding what happens to the brain as it rests. He wants to use imaging technology to see whether the effect of nature on the brain can be measured and whether there are other ways to reproduce it, say, through meditation.

Boy, it sure would be nice to head out with the kids and shoot the rapids for a few days every time I felt overloaded!  Unfortunately NOT one our our family’s economic realities!

Professor Braver’s comments on reproducing the effect of the rafting trip through meditation, however, got me wondering, and also reminded me of a quote that is painted on the wall of my yoga shala – from the 13th century Persian poet, Rumi.

“When you do things from your soul, you feel a river moving in you, a joy”

Although I can’t get away with the kids for a rafting trip, I can – and do – enjoy spending time together in a place where “CrackBerrys” and all other forms of digital technology are not to be found.  A quiet spot in NJ near the, ahem, scenic Rahway River.  One thing my kids have been learning in their children’s yoga classes are the rudiments of mindfulness meditation.  Might this be what Professor Braver had in mind?  Can it help reproduce the cognitive and emotional effects of a river rafting trip?  As noted in the article:

Mr. Strayer, the trip leader, argues that nature can refresh the brain. “Our senses change. They kind of recalibrate — you notice sounds, like these crickets chirping; you hear the river, the sounds, the smells, you become more connected to the physical environment, the earth, rather than the artificial environment.”  … “There’s a real mental freedom in knowing no one or nothing can interrupt you,” Mr. Braver says. He echoes the others in noting that the trip is in many ways more effective than work retreats set in hotels, often involving hundreds of people who shuffle through quick meetings, wielding BlackBerrys.”

Hmmm, this kind of stuff is oft said about meditation.  As many parents fret about their way kids become attached to their digital devices, it is perhaps too early to know whether meditation is an effective counter-balance to the new digital reality.  Can it provide the same cognitive and emotional benefits experienced by the river rafters who were truly “disconnected” for a few days?  Perhaps – with practice, and more practice.  Nevertheless, a relaxing walk through the forest is different for kids today – as their digital devices buzz away in their pockets.  What’s a modern-age kid to do?

To begin to explore this question further, check out these 2 review articles on the physiological and psychological benefits of both meditation and yoga in children.  The first, Sitting-Meditation Interventions Among Youth: A Review of Treatment Efficacy by David S. Black, Joel Milam and Steve Sussman, published in Pediatrics Aug 24, 2009  and Therapeutic Effects of Yoga for Children: A Systematic Review of the Literature by doctors Mary Lou Galantino, Robyn Galbavy and Lauren Quinn from the University of Pennsylvania.

Both articles examine existing scientific evidence – in the form of controlled clinical studies – on whether these very ancient practices provide benefits to kids in the modern world.  In short – they do – but more research is needed to better understand how much benefit is provided.  How many sessions are needed?  Does it last after practicing stops?  How do the benefits work?  How to best engage children of different ages?  From the abstracts:

“Sitting meditation seems to be an effective intervention in the treatment of physiologic, psychosocial, and behavioral conditions among youth.” … “The evidence shows physiological benefits of yoga for the pediatric population that may benefit children through the rehabilitation process, but larger clinical trials, including specific measures of quality of life are necessary to provide definitive evidence.”

Its fun to meditate and fun to spend quiet time with my young children – so there is no real downside to spending some time meditating and “disconnecting” from our digital devices.  Might they be learning a skill that protects their creativity and emotional well-being?  I hope so.  Perhaps one day when they are older, they will email me to let me know!

To learn more about meditation for children, visit The David Lynch Foundation,  UCLA Mindful Awareness Research Center (adapting ancient practices to modern life),  the Committee for Stress-Free Schools, Dr. Elizabeth Reid’s six week curriculum to encourage mindful learning in a class of fourth grade students and an interview with my former postdoctoral mentor on the science of attention training.

Enhanced by Zemanta
The Buddha as an ascetic. Gandhara, 2-3rd cent...
Image via Wikipedia

One shorthand way I’ve come to think about yoga and other eastern religions is that its practitioners become adept at turning their attention away from stress, conflict, tragedy, etc. of mortal life and towards inner sources of tranquility and peace.  Basically, the meditative training helps one to experience a less conflicted and stressed-out life.

With this in mind,  I started Mircea Eliade‘s tome Yoga: Immortality and Freedom where,  in Chapter 1, Eliade – an academic authority on the topic – gets right to THE main point of Yoga and its historical antecedents found in the writings of ancient mystics, ascetics and Samkhya philosophy that sought to understand mortal and immortal components of man:

For Samkhya and Yoga the problem is clearly defined.  Since suffering has its origins in ignorance of “Spirit”  – that is, confusing “Spirit” with psychomental states – emancipation [from suffering] can be obtained only if the confusion is abolished.

OK, so Yoga will help emancipate me from suffering.  In plain-speak,  I will become (with practice) less stressed by the aches and pains and viscisitudes of life, which, in turn, yields a great many health benefits.  Sounds reasonable from a pure science point of view.  Nevertheless, Eliade emphasizes:

From the time of the Upanishads India rejects the world as it is and devaluates life as it reveals itself to the eyes of the sage – ephemeral, painful, illusory.  Such a conception leads neither to nihilism nor to pessimism.  This world is rejected, this life depreciated, because it is known that something else exists, beyond becoming, beyond temporality, beyond suffering.

Reject this world?  Really?  Is it so horrible?  If this life is so ridden with “universal suffering”, then why do yoga teachers always remind us to, “live in the moment”?  In the past months, I’ve been trying to embrace these passing moments … the rays of sun falling through the branches, the sound of the breeze, a momentary expression on my child’s face … you know … the moment.  I was really digging this aspect of yoga and its emphasis on the here and now and embracing the myriad small pleasures in life.  This effort has made my life more peaceful and full.  Eliade pops my yoga bubble further:

Intrinsically, then, this universal suffering has a positive, stimulating value.  It perpetually reminds the sage and the ascetic that but one way remains for him to attain freedom and bliss – withdrawal from the world, detachment from possessions and ambitions, radical isolation.

Is this where a yoga practice leads?  Radical isolation?  Avoiding all these precious so-called “painful” moments (children laughing, birds singing, waves splashing, etc. etc.).  Say it aint so Mircea!  I was really enjoying these moments.  The meditative practice of yoga has brought joy and calm to my everyday experience – an experience of a hundred passing, ordinary moments.

Hope to come to a deeper understanding of this central “Doctrine of Yoga” in the chapters to come.  I suspect that the purpose of Yoga is (from the philosophical point of view) somewhat loftier than to simply make its practitioners more joyful and calmer.  The super hard-core yogis of the past were probably seeking something more profound – full freedom, emancipation, immortality, samadhi etc.

Worthwhile to be sure, but, for me, for now, not at the expense of all the ordinary passing moments in life.

Post script: A closer look at the word “suffering” shows that it is translated from the sanskrit “dukha” which really just means discomfort or tension.  From wikipedia:

“It is perhaps amusing to note the etymology of the words sukha (pleasure, comfort, bliss) and duḥkha (misery, unhappiness, pain). The ancient Aryans who brought the Sanskrit language to India were a nomadic, horse- and cattle-breeding people who travelled in horse- or ox-drawn vehicles. Su and dus are prefixes indicating good or bad. The word kha, in later Sanskrit meaning “sky,” “ether,” or “space,” was originally the word for “hole,” particularly an axle hole of one of the Aryan’s vehicles. Thus sukha … meant, originally, “having a good axle hole,” while duhkha meant “having a poor axle hole,” leading to discomfort.”

So I need not remain hung-up on a tradition that tells me to both “live in the moment” and also “that these precious moments are chock full of suffering”.  Even happy experiences come with some underlying tension and uncertainty.  Indeed, the mind can easily wander its way from a happy to a troubled state in a few seconds.  Yes, there is constant tension to varying degrees in life.  How is it that yoga can help a person minimize their experience of this tension?

Enhanced by Zemanta

Yoga spirit, southern style

Are they practicing breath control?  No.  Are they practicing postures?  No.  Are they desperately seeking meaning and a connection with divinity?  Yes.  Are they pulled in one direction by the wants of the body, and in another direction by the wants of the spirit?  Yes.  Do they cope day to day with grim realities of suffering and loss in a place where, “gravity is stronger and you can feel it pulling you closer into the earth everyday”.  Yes.

These are the very themes of yoga.  Beautifully captured in picture and sound in the 2003 film “Searching for the Wrong-Eyed Jesus“.

One day, each of us may have the dubious pleasure of browsing our genomes.  What will we find?   Risk for this?  Risk for that?  Protection for this? and that?  Fast twitching muscles & wet ear wax?  Certainly.  Some of the factors will give us pause, worry and many restless nights.  Upon these genetic variants we will likely wonder, “why me? and, indeed, “why my parents (and their parents) and so on?”

Why the heck! if a genetic variant is associated with poor health, is it floating around in human populations?

A complex question, made moreso by the fact that our modern office-bound, get-married when you’re 30, live to 90+ lifestyle is so dramatically different than our ancestors. In the area of mental health, there are perhaps a few such variants – notably the deaded APOE E4 allele – that are worth losing sleep over, perhaps though, after you have lived beyond 40 or 50 years of age.

Another variant that might be worth consideration – from cradle-to-grave – is the so-called 5HTTLPR a short stretch of concatenated DNA repeats that sits in the promoter region of the 5-HTT gene and – depending on the number of repeats – can regulate the transcription of 5HTT mRNA.  Much has been written about the unfortunateness of this “short-allele” structural variant in humans – mainly that when the region is “short”, containing 14 repeats, that folks tend to be more anxious and at-risk for anxiety disorders.  Folks with the “long” (16 repeat variant) tend to be less anxious and even show a pattern of brain activity wherein the activity of the contemplative frontal cortex is uncorrelated from the emotionally active amygdala.  Thus, 5HTTLPR “long” carriers are less likely to be influenced, distracted or have their cognitive processes disrupted by activity in emotional centers of the brain.

Pity me, a 5HTTLPR “short”/”short”  who greatly envies the calm, cool-headed, even-tempered “long”/”long” folks and their uncorrelated PFC-amygdala activity.  Where did their genetic good fortune come from?

Klaus Peter Lesch and colleagues say the repeat-containing LPR DNA may be the remnants of an ancient viral insertion or transposing DNA element insertion that occurred some 40 million years ago.  In their article entitled, “The 5-HT transporter gene-linked polymorphic region (5-HTTLPR) in evolutionary perspective:  alternative biallelic variation in rhesus monkeys“, they demonstrate that the LPR sequences are not found in primates outside our simian cousins (baboons, macaques, chimps, gorillas, orangutans).  More recently, the ancestral “short” allele at the 5HTTLPR acquired some additional variation leading to the rise of the “long” allele which can be found in chimps, gorillas, orangutans and ourselves.

So I missed out on inheriting “CCCCCCTGCACCCCCCAGCATCCCCCCTGCACCCCCCAGCAT” (2 extra repeats of the ancient viral insertion) which could have altered the entire emotional landscape of my life.  Darn, to think too, that it has been floating around in the primate gene pool all these years and I missed out on it.  Drat!

Enhanced by Zemanta
animated Young experiment demonstration, animo...
Image via Wikipedia

A few weeks ago my guru passed along a video entitled, “What the BLEEP Do We Know” / “Down the Rabbit Hole” which explores the so-called Double-slit experiments.  In these experiments, it was found that single photons were able to travel through 2 separate slits simultaneously – thus violating all manner of physical laws (how the heck can an object be in two places at the same time?).  Furthermore, it was found that whenever the experimenters (reviewed here) were able to observe, detect, or deduce, which slit a photon travelled through, the typical “dual slit” interference pattern (shown here) instantly disappeared.

Strangely, it seems that interference patterns seem to appear only when a photon’s path is unknown.  Even weirder is that when 2 photons are sent to separate detectors, they seem to “know” whether one-another will generate a specific interference pattern.  This so-called phenomena of “quantum entanglement” and other such examples of spooky action-at-a-distance where 2 separate “widely separated objects share the same existence”  have spawned all manner of new-agey and spiritual endeavors to link these quantum-level phenomena with human spirituality.  Here’s just one example.

A recently published research article entitled, “How much free will is needed to demonstrate nonlocality?” explores the relationship between quantum entanglement and human thought.  According to Technology Review,

“if an experimenter lacks even a single bit of free will then quantum mechanics can be explained in terms of hidden variables. Conversely, if we accept the veracity of quantum mechanics, then we are able to place a bound on the nature of free will.”

Bounds on free will?  Apparently so – if you follow the quantum physics.  Is this a way to think about, or perhaps scientifically validate, the notion of karma?  Perhaps only in a general way – that our thoughts and actions are somehow bounded by the consequences of our choices and experiences as well as the choices and experiences of others in the present and past.

I’m not  free, but happily inter-connected.

Enhanced by Zemanta